Skip to content

Institutul Cantacuzino

Profesionalismul si experienta noastra pentru sanatatea dumneavoastra !

Search Results

Keyword: rezultate

Activitati si rezultate:

Au fost capturati tantari in zonele de studiu din Delta Dunarii utilizand capcane si aspiratoare speciale ( Fig 1-4)

Fig. 1 Colectarea tantarilor vectori cu ajutorul aspiratorului.

Tantarii au fost rapid distribuiti in criotuburi si plasati in recipiente de transport cu azot lichid, in vederea prezervarii virusului. In laborator au fost sortati, identificati si procesati pentru detectia genomului virusului West Nile. Testele de screening s-au efectuat cu ajutorul unui kit pentru revers-transcriere si amplificare genica in timp real. Ulterior au fost amplificate alte tinte moleculare din probele pozitive, iar ampliconii au fost secventiati. Secventele de genom viral au fost analizate. Tantarii hraniti cu sange au fost procesati pentru identificarea sursei pranzului sanguin.

Fig.2 Tantari colectati cu ajutorul capcanei cilindrice amorsate cu pasare

Fig.3. Montarea unei capcane luminoase (CDC light trap)

Fig.4. Capcane “BG sentinel” pentru colectarea tantarilor vectori

Virusul WN circulant in Romania a fost genotipat, a fost stabilita linia genetica din care face parte, genomul acestuia a fost partial secventiat. Secventierea si analiza filogenetica a secventelor obtinute se desfasoara in continuare.
Au fost identificati vectorii primari ai virusului West Nile in ecosistemul Deltei Dunarii
si in ecosisteme urbane si s-a stabilit rata de infectie cu virus WN. S-au identificat si speciile de tantari care actioneaza ca vectori secundari ai virusului WN. Au fost colectate date de bio-ecologie a tantarilor, iar baza de date acumulate este in curs de analiza.
In cursul investigatiilor entomologice a fost gasita, pentru prima data in Romania, o specie invaziva de tantari, cu un potential vector semnificativ, iar autoritatile de sanatate publica au fost informate rapid pentru a lua masurile de control necesare.

Impactul rezultatelor: Cu toate ca in acest stadiu discutam doar rezultate partiale, datele obtinute de noi in legatura cu tantarii-vectori si tulpinile de virus WN circulante in Romania sunt deosebit de valoroase. Contributia noastra la baza de date a consortiului si analiza comparativa a rezultatelor noastre, in raport cu cele obtinute de alti parteneri de proiect, vor fundamenta modelul emergentei si al endemicitatii virusului WN in Europa, care va avea un impact semnificativ la nivelul sanatatii publice, pentru preventia si controlul febrei West Nile.

 

BIOLOGIA SI CONTROLUL INFECTIILOR TRANSMISE PRIN VECTORI IN EUROPA

OBIECTIVE GENERALE URMĂRITE

– Definirea factorilor care moduleaza circulatia diverselor tipuri genetice de virus West Nile si care favorizeaza aparitia epidemiilor in tara noastra si in Europa. Obiectivul a fost realizat 100%.

– Identificarea riscului de circulatie si de transmitere la om a virusurilor transmise de tantari unor virusuri care au ca vectori tantarii –specii autohtone si specii invazive importate. Obiectivul a fost realizat 100%.

ETAPA 1. Elaborarea, armonizarea, standardizarea  si implementarea metodologiei  lucru in laborator si teren: a fost elaborata si testata o metoda standardizata de colectare a probelor biologice, de conservare si transport, de procesare a acestora in laborator si de analiza preliminara,  prin screening molecular, pentru detectia virusului West Nile. Aceasta metodologie de lucru a fost validata prin utilizarea sa in conditii de lucru deosebite , in diferite anotimpuri si zone geografice, cu diversi operatori.  A fost optimizata metoda moleculare de amplificare a unui marker variabil din genomul flavivirusurilor, pentru a fi utilizata in tipizarea tulpinilor circulante ale virusului West Nile si in analiza de epidemiologie moleculara. A fost implementat un protocol de laborator pentru identificarea sursei pranzului sanguin al femelelor de tantari, care a fost utilizat pentru testarea probelor aduse de pe teren . A fost astfel validata ca metodologie de supraveghere a circulatiei a agentilor patogeni transmisi de tantari vectori,  utilizabila atat in studii prospective privind circulatia unor noi arbovirusuri , cat si in programele de monitorizare/supraveghere a activitatii unor agenti patogeni endemici, inclusiv virusul West Nile. Obiectivul a fost realizat 100%.

ETAPA 2.  Colectarea si procesarea probelor biologice si caracterizarea faunei de Culicidae in contextul arealelor de studiu . Au fost colectati si analizati peste 30000 de tantari, peste 200 exsudate cloacale si orale de la pasari domestice si salbatice care au fost analizate pentru prezenta virusului West Nile. Numarul mare de specimene colectate si analizate a permis analiza statistica si obtinerea unor rezultate semnificative, cu valoare confirmatorie. Am configurat principalele componente ( vectori) ale ciclului de transmitere a virusului West Nile in Delta Dunarii, vectorii principali, vectorii secundari si vectorii –punte ( „bridge-vectors”), precum si dinamica populationala a tantarilor vectori ai virusului West Nile  in cursul sezonului de transmitere. Investigatia entomologica din orasul Bucuresti a pus in evidenta, pentru prima data in Romania, o specie invaziva de tantari – tantarul tigru asiatic, un potential vector periculos.   Obiectivele au fost indeplinite 100%.

ETAPA 3. Investigarea relatiei vector-gazda vertebrata si a rolului acesteia in mentinerea si amplificarea virusului West Nile Am stabilit  preferinta de hranire a tantarilor. Au fost secventiate 210 probe de provenite de la tantari hraniti si au fost comparate cu baza de date www.barcodingoflife.com. Astfel s-a putut stabili sursa preferata de sange in cazul femelelor de tantari. Studiul nostru efectuat asupra unor tantari care se adapostesc afara (exofili) a demonstrat ca vectorul urban Culex pipiens sensu lato se hraneste de preferinta pe pasari comune sedentare care pot reprezenta amplificatori ai virusului West Nile in zone urbane si periurbane. A fost stabilita dinamica speciilor de tantari in cursul sezonului de activitate a acaestora, in raport cu peioadele de migratie a pasarilor in Delta Dunarii. Obiectivele fazei au fost indeplinite 100%. In plus, la recomandarea Coordonatorului (CIRAD), am efectuat monitorizarea speciei invazive Aedes albopictus   in orasul Bucuresti si am trimis , in timp real  o informare autoritatilor de sanatate publica precum si, la solicitarea Ministerului Sanatatii, o scrisoare metodologica privind masurile de preventie si control pentru a impiedica stabilirea acestei specii de tantari vectori in tara noastra.

ETAPA 4. Particularitatile circulatiei virusului West Nile in Romania, elaborarea hartilor de risc si evaluarea riscului de transmitere la om. Au fost caracterizate izolatele de virus West Nile obtinute si s-a stabilit filogenia lor moleculara. Datele moleculare aduc dovezi suplimentare privind endemicitatea acestui virus în ţara noastră.. Deasemenea am determinat zonele geografice si tipul de ecosistem in care circulatia virusului West Nile este activa si in care riscul de transmitere la om este crescut.  Factorii corelati cu riscul transmiterii la om a virusului West Nile au fost:  vecinatatea ecosistemelor umede populate de pasari acvatice migratoare si infestate cu tantari, abateri pozitive semnificative ale temperaturii medii lunare, o cantitate de precipitatii suficienta pentru mentinerea habitatelor larvare, dar sub media multianuala. Tara noastra se mentine intr-o zona favorabila introducerii virusului West Nile, prin pasari migratoare ori paraziti ai acestora, si in care virusul gaseste conditii favorabile transmiterii endemice. Obiectivul a fost indeplinit 100% .

Participantii aflati in stagiu doctoral si postdoctoral au efectuat cursuri de pregatire in domeniile: Utilizarea sistemului de informatii geografice (GIS), Biosiguranta pentru laboratoarele BSL 3 si 4, Entomologie medicala si controlul vectorilor, Diagnosticul virusului West Nile. De asemenea au participat cu comunicari stiintifice la patru Conferinte Nationale, la meeting-urile anuale ale proiectului, au efectuat o vizita de lucru pentru schimb de experienta, au participat la patru ateliere de lucru interrnationale, la  patru Conferinte internationale, si doua Congrese internationale.

In cursul proiectului au fost elaborate 2 teze de doctorat : unul dintre doctoranzi a obtinut titlul de „ doctor in biologie” , iar al doilea doctorand al proiectului isi finalizeaza teza.

Rezultatele se utilizeaza in sanatatea publica in evaluarea riscului, stabilirea zonelor afectate, organizarea supravegherii si controlului vectorilor, precum si a circulatiei virusului West Nile. Aceste rezultate se coroboreaza cu cele obtinute la nivelul intregului consortiu, fiind utilizate la elaborarea unor modele la nivel continental cu impact asupra imbunatatirii sanatatii cetatenilor europeni.

 

Cabinetele medicale individuale, centrele de diagnostic, laboratoarele medicale, alte unitati sanitare de stat si private, institutii si firme pot incheia contracte de prestari servicii cu INCDMI Cantacuzino pentru analize medicale. Acestea se efectueaza cu plata pe loc sau lunar pe baza de factura.
Unitatile interesate sa incheie un astfel de contract se vor adresa laboratorului de analize medicale pentru a obtine formularul de contract.
Dupa completarea si semnarea in doua exemplare, acestea se vor transmite prin curier sau prin posta cu confirmare de primire pe adresa: INCDMI Cantacuzino, Laboratorul de analize medicale, Splaiul Independentei 103, 050096 Bucuresti. In cel mai scurt timp va vom remite un exemplar semnat de conducerea INCDMI Cantacuzino, pe adresa indicata de dumneavoastra in contract.
Pentru discutarea aspectelor legate de volumul prestatiilor, conditiile de recoltare si transport, eliberarea rezultatelor, tarife, discounturi, va invitam la sediul INCDMI Cantacuzino.

Activities and results:

Mosquitoes have been captured in Danube Delta and other study areas, using special traps and back pack aspirators (Fig 1-4)

Fig. 1 Collecting mosquitoes with the back-pack aspirator

Mosquitoes were rapidly distributed in cryotubes and placed in dry nitrogen shippers to preserve the ARN virus. Back in the laboratory they were identified and processed for West Nile virus (WNV) genome detection. Screening tests were performed using a reverse-transcription and real-time PCR kit (Taqman assay). RNA from positive samples has been subsequently used to amplify specific molecular targets. Amplification products have been sequenced and nucleotides sequences analyzed. Blood engorged mosquito females have been used to analyze the blood meal source.

Fig.2 Mosquitoes collected with the bird- baited trap

Fig.3. Fixing a CDC light trap

Fig.4. “BG sentinel” traps to collect mosquitoes

WNV circulating in mosquitoes in Romania and causing human disease has been genotyped, the genetic lineage has been established, and the viral genome of various virus isolates was partially sequenced. Sequencing and sequence analysis are still in process.
Mosquitoes which are acting as primary WNV vectors in the deltaic ecosystem and in urban ecosystem were identified and their relative infection rate with WNV was established… Secondary vectors were also identified and bio-ecological data on vector populations were collected. The data base analysis is in process.
During the entomological investigations an invasive mosquito species, with high vector potential was found for the first time in Romania. Public Health authorities were informed in timely manner to take control measures.

Impact of obtained results: Although only partial results are discussed at this stage, the findings regarding both the vectors and the West Nile virus (WNV) strains circulating in Romania are valuable. Our contribution to the data base of the consortium, and the analysis of our results in comparison with those obtained by the other partners, will fundament the model of emergence and of endemicity of WNV in Europe, a model with a significant public health impact, in respect to prevention and control of West Nile fever.

 

BIOLOGY AND CONTROL OF VECTOR-BORNE INFECTIONS IN EUROPE

 EDENext

ABSTRACT

Following the unprecedented epidemic of West Nile fever in southeasternRomaniain 1996,  West Nilevirus (WNV) which is spreading along bird migration pathways and is circulating in bird-mosquito cycles, became endemic in this country. Another significant outbreak was recorded in 2010 year produced by a strain belonging to a differentWest Nilevirus genetic lineage. Multiple strains of West Nile virus were detected and caused outbreaks in other Southern European countries, as well as inCentral Europe, becoming a real threat for European citizens, in the context of climate and  environmental changes. The partnership EDENext project on the biology and control of vector-borne infections in Europe aimed, in a coordinated international effort, to understand and explain eco-epidemiology of vector-borne infections, including mosquito-borneWest Nilevirus, as well as defining the risk of invasive vector species. Our goals were to understand the mechanisms of WNV emergence, maintenance and amplification in natural and urban ecosystems, and of its molecular evolution, via virus genome sequencing and bio-informatics analysis.

As a partner,  INCDMI Cantacuzino multidisciplinary team, involving entomologists, microbiologists, medical and veterinary doctors, as well as molecular biologists, participated in the study of emergence and spread of mosquito-borne virus infections and of the biology of the mosquito vectors.  Our work was based on two main areas of study: Danube Delta plus the Razim lagoon complex, and the urban area of Bucharest, plus the periurban Ilfov area. Regular monthly field trips were performed in Danube Delta and mosquitoes were collected using a variety of mosquito-traps. Weather parameters were monitored. In Bucharestarea mosquito collections were performed at the end of summer, in areas where human West Nilefever cases were recorded. Mosquitoes where identified and analyzed for the presence of WNV genome. In positive samples the virus was sequenced and a phylogenetic analysis was performed. As well we analyzed the source of blood of female mosquitoes to identify the preferred vertebrate hosts, thus identify the components of the transmission cycles in urban and periurban area.  We identified the principal and the secondary mosquito vectors of West Nilevirus in the deltaic ecosystem, as well as the bridge vectors which may transmit the virus to humans, and characterized the structure of mosquito community in different ecosystems. A significant progress has been made in the knowledge of the ecological succession of mosquito vector populations and their role in the maintenance and amplification of West Nilevirus. The urban vector of West Nile virus was confirmed and its role in the overwintering of West Nilevirus was revealed.  The virus infection rate in mosquitoes was calculated using a dedicated software, and statistical analysis of the correlation between weather parameters and mosquito abundance, on one side, and the West Nilevirus infections rate in mosquito populations, on the other side,  was performed. Scientific results new to science pointed out to the mechanisms of introduction of West Nile virus into Romaniaand its maintenance in mosquito population explaining the endemization process. The preferred hosts of urban vectors were identified and the mechanisms of virus maintenance via vertical transmission was demonstrated. Entomological investigation of urban area of  Bucharestfound the presence and establishment in the city of the invasive vector species Aedes albopictus, the Asian tiger mosquito, which was involved in autochthonous transmission of imported Dengue and Chikungunya viruses in southern France, Italy and Croatia in recent years. These findings were immediately communicated to public health authorities and a methodology for control was also distributed. We became aware of the risk of dengue virus introductions via infected travelers and performed a study on the molecular epidemiology of dengue viruses imported into Romania, as it was known that some dengue virus genotypes are more prone to transmission by Aedes albopictus than others. An in depth molecular study of West Nile viruses circulating in southeastern Romania documented the mechanism of endemization of the virus in this area and the variety of virus lineages  circulating in mosquito populations in Danube Delta. Weather conditions correlated withWest Nile virus upsurge and outbreak risk were determined. Our data are used for a standardized methodology for surveillance of mosquito vectors and for risk assessment forWest Nile virus transmission,  taking into account weather, environmental and vector populations and mosquito species community parameters. These results are completing a very complex puzzle of eco-epidemiology of West Nile virus inEurope, and are fundamental for risk assessment at continental level, and for better programs of control of transmission to humans.

 

Brief presentation of the goals of project (source: http://www.edenext.eu/ )

The EDENext Consortium is investigating the biological, ecological and epidemiological components of vector-borne disease introduction, emergence and spread, and the creation of new tools to control them. Due to environmental and socio-economic changes, vector-borne diseases (VBD) are becoming an increasing challenge for human and veterinary public health not only in Europe, but across the globe.
Emerging infectious diseases (EID) are often detected in Europe and North America but also pose major risks for developing countries, where many factors favour the emergence of VBD and there are limited health facilities to prevent, monitor or control their spread. Therefore the work of EDENext is not only as a means of protecting and improving public health and the welfare of European citizens, but part of a coordinated international effort.

EDENext builds on the concepts, methods, tools and results of the earlier EDEN project (Emerging diseases in a changing European environment). It is using the same general approach of understanding and explaining biological, ecological and epidemiological processes in order to develop a set of state-of-the-art methods and tools to improve prevention, surveillance and control of vector populations and VBD. However, while EDEN focused on the effects of environmental changes on the emergence of VBD, EDENext is seeking to explain and model the processes leading to the introduction, establishment and spread of vectors and/or VBD, and to assess the possible control strategies to break the epidemiological cycles of VBD. EDENext is a public health oriented project.

Following the successful formula established by EDEN, the project is organised around a set of vertical disease-related activities linked by horizontal themes which provide integrated technical input to the vertical groups, minimising duplication and ensuring a coordinated approach throughout the project.

Role of the National Institute of Research and Development for Microbiology and Immunology Cantacuzino in EDENext project.

INCDMI Cantacuzino: partner 22, acronym NIRDMI.

Background: NIRDMI team is involved in the following WP of EDENext project: “Emergence and spread of mosquito-borne diseases”. The main focuses of our activity are the mechanisms of emergence, of amplification and endemic maintenance of the West Nile virus (WNV) in the Danube Delta, as well as in other areas of virus activity. WNV is a mosquito-borne virus endemic in Romania. In 1996 and 2010 significant WNV outbreaks in humans have occurred, and the virus is transmitted to humans year after year, human cases being recorded in every transmission season. The bio-ecology of mosquito vectors and is studied, as well as the influence of climate changes on vectors and virus transmission.

The objectives of our activity are addressing both vectors and virus:

  • Mosquito vectors: we aim at identifying main mosquito-vectors of WNV, their blood-meal host preference, the dynamics of their populations across the transmissions season under the weather influence, their survival rate over winter, the WNV infection rate of different mosquito species;
  • West Nile virus (WNV): our goals are to understand the mechanisms of WNV emergence, maintenance and amplification in natural and urban ecosystems, and of its molecular evolution, via virus genome sequencing, and bio-informatics analysis.

Project title: EDENext—Biology and control of vector-borne infections in Europe
Website: http://www.edenext.eu/
Grant No: 261504

Call identifier: FP7-HEALTH-2010-single-stage
Type of project: collaborative project
The project is involving 46 partner institutions from 21 countries
( http://www.edenext.eu/the-project/who-we-are )

Date of start: 2011/01/01
End: 2014/12/31

The National Institute of Research and Development for Microbiology and Immunology Cantacuzino is partner 22 with the acronym NIRDMI.

The total budget of the project for NIRDMI partner is 254160 euro:

  • an amount of 190620 euro (75%) is provided by EC;
  • an amount equivalent to 25%, the co-financing of 252502 LEI, is provided by the Executive Agency for Higher Education, Research, Development and Innovation Funding (UEFISCDI) in the framework of the National Program PNII, Capacities, Module III FP7, project 147-1EU/2011.

Team: Dr. Cornelia S Ceianu (team coordinator, virologist), Dr Gabriela Oprisan (molecular virologist), Dr Daniela Badescu (microbiologist), Dr Ani Ioana Cotar (molecular microbiologist), Dr Elena Falcuta (entomologist), Dr Liviu Prioteasa (entomologist), Raluca Ioana Panculescu-Gatej (PhD fellow, biochemist), Sorin Dinu (PhD fellow, biochemist, Dr Coman Cristin (veterinarian), Ghergus Marinela (economist, financial manager). The following technicians were also involved in project activities: Valentina Teodorescu, Anca Stefan, Silvia Enache, Dana Popescu.

Two PhD theses are developed within this project by PhD fellows Sorin Dinu and Raluca Ioana Panculescu-Gatej.

Scurta prezentare a obiectivelor proiectului (sursa: http://www.edenext.eu/)

Consortiul EDENext investigheaza componentele biologice, ecologice si epidemiologice implicate in introducerea, emergenta si controlul infectiilor transmise prin vectori; de asemenea elaboreaza noi metode pentru controlul acestora. Din cauza schimbarilor de mediu, climatice si socio-economice, bolile transmise de vectori reprezinta o provocare crescanda pentru sanatatea publica si animala atat in Europa, cat si la nivel global. Activitatea EDENext este orientata spre protectia si cresterea calitatii vietii pentru cetatenii europeni, ca parte a unui efort international pentru monitorizarea si reducerea impactului negativ al patogenilor transmisi de artropode si rozatoare.

EDENext se bazeaza pe conceptele, metodele si rezultatele unui proiect anterior: proiectul EDEN, desfasurat in PC6 ( EDEN project (Emerging diseases in a changing European environment).
Proiectul abordeaza procesele biologice, ecologice si epidemiologice care guverneaza circulatia agentilor patogeni transmisi prin vectori, si dezvolta metode avansate si instrumente utilizabile pentru preventia, supravegherea si controlul populatiilor de vectori si a bolilor infectioase transmise de acestia. In timp ce proiectul EDEN s-a focalizat pe influenta schimbarilor de mediu asupra populatiilor de vectori, noul proiect, EDENext, este orientat spre sanatatea publica, spre intelegerea mecanismelor emergentei si a evaluarii strategiilor de control prin intreruperea ciclurilor epidemiologice ale infectiilor transmise prin vectori.

Proiectul EDENext este structurat pe subproiecte verticale dedicate unor grupuri de vectori (tantari, capuse, rozatoare, flebotomi) si patogeni/paraziti pe care acestia ii transmit, conectate prin teme orizontale care asigura subproiectelor un input tehnic integrat, reducand la minimum activitatile redundante si asigurand o abordare coordonata la nivelul intregului proiect.

Rolul Institutului National de Cercetare–Dezvoltare pentru Microbiologie si Imunologie Cantacuzino (partenerul no.22, cu acronimul NIRDMI) in proiectul EDENext

Echipa INCDMI Cantacuzino participa la pachetul de lucru cu tema: “Emergenta si raspandirea bolilor transmise prin tantari-vectori” si investigheaza mecanismele emergentei, amplificarii si mentinerii la nivel endemic a virusului West Nile (WN) in Delta Dunarii si in alte zone din tara. Virusul WN este transmis de tantari si este endemic in Romania. In 1996 si 2010 au avut loc epidemii semnificative de meningo-encefalita West Nile, virusul fiind transmis la om si in perioadele inter-epidemice. Se investigheaza bio-ecologia tantarilor vectori, ca si influenta modificarilor climatice asupra populatiilor de vectori si asupra circulatiei si mentinerii endemice a virusului West Nile.
Obiectivele activitatii noastre sunt legate atat de tantarii vectori, cat si de agentul patogen viral luat in studiu:

1. Tantarii vectori:
Obiectivele noastre sunt: identificarea principalilor vectori ai virusului WN, a preferintei lor de hranire (pranz sanguin), a altor trasaturi biologice ale vectorilor ca diapauza, rata de supravietuire peste iarna, precum si susceptibilitatea la infectia cu virus WN a diferitelor specii de vectori.

2. Virusul West Nile:
Obiectivele noastre sunt: intelegerea mecanismelor emergentei virusului WN, ale mentinerii si amplificarii virusului, ale persistentei peste iarna; secventierea genomului viral, analiza filogenetica si descifrarea mecanismelor moleculare de evolutie a virusului WN.
Aceste investigatii sunt desfasurate de o echipa multidisciplinara complexa care include microbiologi, biochimisti, entomologi, specialisti in biologie moleculara, medic veterinar, cu expertiza complementara pentru indeplinirea obiectivelor proiectului.

 

Titlul proiectului: Biologia si controlul infectiilor transmise de vectori in Europa. Acronim EDENext

Site web: http://www.edenext.eu/

Identificatori: competitia FP7-HEALTH-2010-single-stage, grant no 261504
Tip de proiect: proiect colaborativ

La proiect participa, in calitate de parteneri, 46 institutii din 21 de tari. (http://www.edenext.eu/the-project/who-we-are)

Data inceperii proiectului: 01/01/2011.
Data incheierii proiectului: 31/12/2014

Institutul National de Cercetare – Dezvoltare pentru Microbiologie si Imunologie Cantacuzino este partenerul nr. 22, cu acronimul NIRDMI.

Bugetul total al proiectului este 254 160 euro:

  • Un cuantum de 75% din bugetul proiectului este asigurat prin grantul European (190620 euro);
  • Un cuantum de 25 %, reprezentand cofinantarea proiectului (252 502 LEI) este furnizat de catre UEFISCDI prin Programul Capacitati ( PNII), Modulul III FP 7, proiectul 147-1EU/2011.

 

Echipa: Dr. Cornelia S Ceianu (coordonator echipa), Dr Gabriela Oprisan, Dr Daniela Badescu , Dr Ani Ioana Cotar , Dr Elena Falcuta , Dr Liviu Prioteasa , Doctorand Raluca Ioana Panculescu-Gatej , Doctorand Sorin Dinu , Dr Coman Cristin, Ghergus Marinela (economist, manager financiar). Urmatorii asistenti medicali au participat de asemenea la activitatile proiectului: Valentina Teodorescu, Anca Stefan, Silvia Enache, Dana Popescu.

In cadrul proiectului se desfasoara activitatea experimentala pentru doua stagii doctorale (doctoranzi Sorin Dinu si Raluca Ioana Panculescu-Gatej).

Rezumat Etapa I – 2012
Stabilirea metodologiei de lucru si a algoritmului de recrutare a pacientilor

Terapia curentă anti-HCV cu interferon pegilat asociat cu ribavirină (PEG-IFN/RBV) nu este eficientă la toţi pacienţii (cazul majorităţii celor infectaţi cu genotipul 1b) datorită selectării mutaţiilor de rezistenţă şi a unei sensibilităţi mai scăzute la antivirale a acestui genotip. In plus, terapia este greu suportată de pacienţi şi are efecte adverse. In urma unui studiu anterior al grupului nostru de cercetare privind distribuţia genotipurilor HCV în Romania, am identificat genotipul 1b ca fiind predominant (86.4%), urmat de 1a (10.7%) şi de 4a (2.9%), acesta din urmă ca genotip emergent (Sultana C, 2011).

Proiectul îsi propune să definească factorii de predictie a răspunsului la terapia PEG-IFN/RBV prin analiza integrată a factorilor virali precum si a factorilor de gazdă. Unul dintre obiectivele proiectului HepGen este de a produce informatii care conduc la deciziile de tratament, bazate atit pe informatii privind virusul cit si pe cele privind profilul genetic al pacientului.

Obiectivele etapei 1 (conform Planului de realizare) sunt:

– Elaborarea modelului experimental pe baza documentatiei din literatura de specialitate
– Constructie pagina web a proiectului
– Selectarea si optimizarea protocoalelor de lucru pentru si studierea markerilor virali de resistenta la tratment
– Stabilirea criteriilor de constituire a loturilor de pacienti inclusi in studiul prospectiv
– Constituirea unui lot pentru studiul retrospectiv. Distribuirea probelor in cadrul consortiului
– Alcatuirea bazei de informatii referitoare la pacientii inclusi in studiu
– Stabilirea protocolului de lucru pentru dozarea unor markeri serologici predictivi pentru evolutia raspunsului la tratament
– Optimizarea protcolului de lucru pentru studierea unor markeri genetici umani
– Determinarea incarcaturii virale pre/post-tratament la 4, 12, 24/48 saptamani si la sase luni dupa tratament
– Kick-off meeting

Elaborarea modelului experimental pe baza documentatiei din literatura de specialitate
In aceasta faza institutia coordonator a fost implicata, impreuna cu toti partenerii, in Elaborarea modelului experimental pe baza documentatiei din literatura de specialitate (activitatea I.1 din planul de realizare).

Constructie pagina web a proiectului (I.2): pe site-ul institutiei coordonator INCDMI Cantacuzino http://www.cantacuzino.ro/ro/
exista link catre proiectul HepGen nr 88/2012: http://www.cantacuzino.ro/ro/?p=1713
unde sunt postate date despre proiect (Prezentare generala, Componenta Parteneriatului, Bugetul proiectului, Rezumatul si Obiectivele). Toate documentele postate pe site sunt create cu concursul tuturor partenerilor din consortiu.

Selectarea si optimizarea protocoalelor de lucru pentru studierea markerilor virali de resistenta la tratment

Factorii virali care concura la raspunsul la tratament sunt: genotipul HCV, incarcatura virala inainte de tratament, cinetica virala sub tratament si diversitatea virala.
In timpul replicarii, HCV are particularitatea de a genera unele variante virale (cvasispecii) care difera intre ele prin mutatii (pina la 10% din intregul genom). Aceasta variabilitate virala importanta conduce la grade diferite de sensibilitate fata de terapia HCV (Asselah, 2010).
In literatura de specialitate au fost semnalate diferite zone din genomul virusului hepatitei virale care pot fi corelate cu rezistenta la tratament. Pentru a evalua contributia variabilitatii virale in raspunsul la tratament am ales 3 gene din structura HCV la nivelul carora se vor face comparatii de secventa intre virusurile provenite de la pacienti sensibili cu cele provenite de la pacienti rezistenti la tratament.

Am selectat, testat si optimizat RT-PCR in trei zone genomice, utilizand un lot de 20 de seruri constitutit de P1. ARN viral este extras din plasma/serul uman, reverstranscris si amplificat prin heminested/nested PCR. Primerii utilizati pentru amplificarea celor trei regiuni au fost selectati din literatura sau construiti in laborator. Ampliconii rezultati au fost purificati din gel si secventiati direct in ambele sensuri. Secventele au fost analizate si editate cu softul BioEdit. Rezultatele obtinute prin interogarea bancilor de secvente cu algoritmul BLAST au confirmat specificitatea fiecarei zone amplificate. Rezultatele optimizarilor au servit la alcatuirea a trei documente „Procedura standard de operare” ce vor fi utilizate pentru procesare si analiza probelor colectate in cadrul proiectului.

Optimizarea protcolului de lucru pentru studierea unor markeri genetici umani

In aceasta etapa au fost optimizate metodele moleculare de studiu al unor markeri umani (factori de gazda) care concura la raspunsul la tratament: grupul alelelor HLA-B27 (asociate cu clearance-ul viral spontan in cazul infectiei acute cu HCV) si doua dintre cele mai frecvente polimorfisme cu importanta farmacogenetica la pacienti cu HCV, identificate in gena ITPA in populatia caucaziana.
Optimizarea acestor metode moleculare a fost realizata pe 12 probe de sange periferic recoltat de la pacienti cu si fara infectie HCV in antecedente. Pe baza testelor de optimizare au fost realizate procedurile standard de operare (POS) ce vor fi utilizate in studiul markerilor genetici umani in cadrul proiectului.

Stabilirea criteriilor de constituire a loturilor de pacienti inclusi in studiul prospectiv

Partenerul 1 a pus la dispozitia consortiului documentele elaborate de participantii acestuia pentru procedurile de recrutare si monitorizare a pacientilor in cadrul studiului. Aceste documente sunt:
1. Consimtamant informat – Anexele 1 si 2
2. Buletinul de insotire a probelor HepGen – Anexa 3
3. Conditii preanalitice pentru prelevarile de sange T0 – Anexa 4
4. Chestionar de recrutare pentru baza de date – Anexa 5
5. Model de introducere in baza de date – Anexa 6

Constituirea unui lot pentru studiul retrospectiv. Distribuirea probelor in cadrul consortiului: a fost agreat in consortiu numarul total de 20 cazuri, dintre care 10 pacienti cu raspuns virusologic sustinut (RVS) si 10 pacienti pentru care este documentata una din formele de esec terapeutic (non-RVS).

In spitalul Victor Babes (P1) a fost selectat un numar de 11 pacienti RVS si 11 pacienti non-RVS ca lot retrospectiv, dintre care de la 2 pacienti non-RVS au fost disponibile serurile de la intierea tratamentului si dupa tratament. Cele 24 de seruri au fost transmise coordonatorului pentru optimizarea protocoalelor de PCR si secventiere pentru markerii virali.

Determinarea incarcaturii virale pre/post-tratament la 4, 12, 24/48 saptamani si la sase luni dupa tratament:
S-au efectuat un numar de 7 recrutari de pacienti in studiul HepGen, la partenerul P1/SVB si 4 recrutari la partenerul P2/ICF (institutul Clinic Fundeni). Conform protocolului agreat in consortiu s-a efectuat incarcarea virala HCV la momentul de initiere a tratamentului (T0) atit la lotul retrospectiv cit si la primii 11 pacienti recrutati in proiectul HepGen si s-au preparat stocuri de ser pastrate la -80°C la P1/SVB. Pentru aceste stocuri s-a creat o baza de date pentru a inregistra toate modificarile operate in cadrul colectiei: transfer de alicote la parteneri pentru testari ARN-HCV sau biomarkeri de interes pentru studiu, efectuarea unor teste suplimentare la P1/SVB.

Serurile trimise catre coordonator au fost testate in laboratorul partenerului P1/SVB pentru ARN-HCV, printr-o metoda comerciala validata pentru diagnostic in vitro. Toate documentele de lucru si cele generate in cadrul activitatilor HepGen precum si inregistrarile fizice sau electronice legate de studiul HepGen sunt pastrate in laboratorul de Virusologie, Imunologie, Biologie Moleculara al P1/SVB, cu exceptia documentelor transferate la perteneri si coordonator in momentul transferului de produse biologice.

In urma cererii coordonatorului catre comisia de etica din INCDMI Cantacuzino privind aprobarea studiului si a documentelor anexate (Consimtamant informat al pacientului, Buletinul de insotire a probelor HepGen, Conditii preanalitice pentru prelevarile de sange T0, Chestionar de recrutare pentru baza de date) a fost obtinut avizul comisiei de etica : Raport de evaluare nr CE/16 din 26.11.2012.

Kick-off meeting

Coordonatorul a organizat la sediul sau (INCDMI Cantacuzino) o intilnire cu toti partenerii – Kick-off meeting (activitatea I.10 din planul de realizare) din 3 octombrie. O a doua intilnire cu toti partenerii a avut loc la sediul P1 (Spitalul Clinic de Boli Infectioase si Tropicale “Dr V Babes”) in data de 26 octombrie.
In cadrul acestor intalniri s-au discutat urmatoarele:

  • tipul studiului
  • organizarea loturilor de pacienti
  • consimtamant informat : toti pacientii vor semna un formular de consimtamant informat inainte de inrolarea in studiu. Documentele anexate cuprind: consimtamantul principal, in care pacientul este informat despre participarea spitalului in cadrul proiectului de cercetare si posibilitatea de a face parte din lotul de studiu si consimtamantul pentru prelevare de probe in scopul testelor genetice, bazat pe standardul oferit de partenerul P4, care are expertiza in acest domeniu
  • Criteriile de constituire a loturilor de pacienti inclusi in studiul prospectiv: Criteriile de includere/excludere au la baza protocoalele CNAS in vigoare (Monitorul Oficial al Romaniei/ 10.06.2010/ pg 66-70), la care se adauga cateva criterii stabilite cu toti partenerii
  • Alcatuirea bazei de informatii referitoare la pacientii inclusi in studiu
  • Evaluarea fibrozei in cadrul lotului de studiu

 

 

Proiect 88/2012 HepGen

Raport stiintific si tehnic

 

Etapa II

1 ian 2013-30 noiembrie 2013

Studiul markerilor virali si genetici umani utilizabili pentru predictia evolutiei infectiei la pacienti tratati si netratati

Rezumatul etapei

 

La INCDMI Cantacuzino (Co) au fost amplificate si secventiate in gena HCV core 101 probe (79 seruri provenite de la Spitalul V. Babes si 22 seruri provenite de la Inst. Clinic Fundeni) provenite de la pacienti naivi pentru tratament sau de la pacienti non-responderi la tratament. Genotipul 1b este majoritar (97%) dar circula si alte genotipuri (1a si 4a) in procent de 3%. Au fost selectaţi pacienţi cu hepatită cronică cu virus C subtip 1b din lotul retrospectiv furnizat de partenerul 1 (Spitalul V. Babes) pentru evaluarea profilului de rezistenţă la noile terapii cu antiproteazice a variantelor HCV circulante la pacienţii din ţara noastră. Pentru atingerea acestui obiectiv, a fost studiată regiunea NS3 protează prin secvenţierea directă. P1, Co si P4  au fost implicati in selectarea unor tulpini virale pentru secventierea integrala a genomului prin tehnologia next generation. In cursul anului 2013 au fost recrutati un numar total de 87 pacienti in cadrul Spitalului Victor Babes (SVB – P1) si s-au efectuat testari si stocuri pentru 20 pacienti recrutati la Institutul Clinic Fundeni (ICF). S-a efectuat monitorizarea in cursul tratamentului standard al hepatitei virale cronice de tip C pentru totalul de 106 pacienti recrutati de la inceputul proiectului. S-au alcatuit bazele de date cu informatii ale pacientilor si rezultatele investigatiilor efectuate in cadrul spitalului. Au fost efectuate un total de 343 teste de incarcatura virala HCV. RVR au obtinut 19 pacienti (18.1%). Pana la 1 noiembrie 2013 un total de 6 pacienti au incheiat tratamentul de scurta durata (6 luni), datorita raspunsului virusologic rapid, avand viremii nedetectabile la sfarsitul tratamentului Pe parcursul  etapei, Institutul Clinic Fundeni (P2) a evaluat 26 de pacienti cu infectie cronica VHC la care s-a initiat tratament cu Peginterferon (α2a sau α2b) si Ribavirina Pacientii au fost evaluati la momentul initierii tratamentului pentru evaluarea posibililor factori de risc in ceea ce priveste modalitatea de infectare, precizarea  datelor demografice, stabilirea comorbiditatilor, efectuarea  examenului fizic (inclusiv calcularea IMC) si recoltarea probelor biologice. De asemenea, pacientii au fost evaluati ecografic si prin efectuarea Fibroscan (ca si metoda non invaziva de evaluare a fibrozei hepatice). Partenerul 3 (Institutul de Virusologie „Stefan S. Nicolau”) a realizat prelucrarea si testarea  probelor (plasma, ser, ADN genomic, ARN plasmatic) recoltate de la 126 pacienti recrutati de partenerii 1 si 2, analiza markerului genetic uman SNP IL28B rs12979860, testarea nivelului seric al  IP10 – factor predictiv al raspunsului la tratament, optimizarea  protocolului de lucru pentru un nou marker seric de predictie a raspunsului la tratament- sCD26, ce va fi testat la toti pacientii inclusi in studiu. Partenerul 4 (Personal Genetics) a studiat factorii genetici de gazda HLA-B27 si ITPA prin metode bazate pe tehnologia PCR pe un lot constituit din 100 de pacienti infectati cu HCV. Activitatățile aferente acestei etape au avut drept scop secvențierea de mare randament (next-generation sequencing) a genomului HCV 1b provenind de la un număr de 11 pacienți și o secvență de control, în vederea caracterizării diversității genetice a virusurilor și identificării unor mutații asociate cu rezistența la tratament. Experimentul se bazează pe utilizarea platformei de pirosecvențare de mare randament Genome Sequencer FLX, produsă de Roche (454 Sequencing). In concluzie, toate activitatile prevazute in planul de realizare au fost indeplinite integral.

Proiectul îsi propune să definească factorii de predictie a răspunsului la terapia PEG-IFN/RBV prin analiza integrată a factorilor virali precum si a factorilor de gazdă. Unul dintre obiectivele proiectului HepGen este de a produce informatii care conduc la deciziile de tratament, bazate, atit pe informatii privind virusul cit si pe cele privind profilul genetic al pacientului.

Studiul markerilor virali de rezistenta la tratament

Tulpinile HCV prezintă o diversitate genetică foarte mare datorită ARN replicazei care nu posedă mecanisme „proof-reading”. Conform clasificării actuale, tulpinile HCV sunt grupate în 6 genotipuri (1-6), acestea fiind divizate în multiple subtipuri virale cu o distribuţie geografică cunoscută. Genotipurile sunt diferite la nivelul secvenţei nucleotidice în proporţie de 31-33% iar subtipurile în proporţie de 20-25%. Genotipul viral este un predictor important al răspunsului la tratament. Genotipurile 1 şi 4 sunt în mod intrinsec mai rezistente la acţiunea interferonului alfa şi a ribavirinei comparativ cu genotipurile 2 şi 3. Proteina core rezultă prin clivarea poliproteinei virale de către enzimele gazdei. Această proteină înalt conservată conţine 191 resturi de amino-acizi (21 KDa) şi intră în structura nucleocapsidei virale. Recent s-a demonstrat că proteina de capsidă core este implicată în carcinogeneză. S-a constatat asocierea dintre mutaţiile din poziţiile 70 şi 91 din proteina core cu rezistenţa la PEG-interferon asociat cu ribavirină. În poziţia 70, arginina (R) este înlocuită cu glutamină (Q) sau, mai rar, cu histidină (H), iar în poziţia 91 leucina (L) este substituită cu metionină (M). Efectele mutaţiilor din poziţiile core 70 şi 91 asupra expresiei genei core şi a funcţiilor proteinei nu sunt cunoscute. Spre deosebire de Japonia, în Europa şi SUA aceste poziţii mutante din gena core a virusului hepatitei C sunt putin studiate iar rezultatele sunt contradictorii.

La INCDMI Cantacuzino au fost amplificate si secventiate in gena HCV core 101 probe (79 seruri provenite de la Spitalul V. Babes si 22 seruri provenite de la Inst. Clinic Fundeni) provenite de la pacienti naivi pentru tratament sau de la pacienti non-responderi la tratament. Prin secventiere probele de HCV au putut fi genotipate – genotipul 1b fiind majoritar (97%) si alte genotipuri (1a si 4a) in procent de 3%.

Privind cele doua mutatii din gena core, cu potential predictiv pentru raspunsul la tratament, 51% au prezentat numai mutatia 70, un procent mai mare (74%) au prezentat mutatia 91 iar 41,5% au prezentat ambele mutatii. Raspunsul viral concretizat prin negativarea incarcaturii virale, evaluat la 4 saptamini (RVR) si la 12 saptamini (EVR) poate anticipa raspunsul viral sustinut (SVR) dupa incetarea tratamentului. Rezultatele noastre indica faptul ca, dintr-un total de 74 de cazuri de pacienti naivi pentru tratament, 47% au obtinut EVR. Dintre pacientii care nu au avut EVR, respectiv o scadere a viremiei cu >2 log sau o negativare a acesteia la 12 saptamini de la inceperea tratamentului cu interferon si ribavirin, 54% prezentau virus cu ambele mutatii in gena core si numai 9.7% cu nici o mutatie in aceasta gena. Consideram ca aceste date indica un potential predictiv pentru raspunsul la tratament al muatiilor din gena virala core.

Studiul markerului genetic uman SNP IL28B rs12979860 de catre Partenerul 3 (Institutul de Virusologie „Stefan S. Nicolau”)

Au fost testati 126 de pacienti infectati VHC inclusi in studiu pana in aceasta etapa, (58.9% femei, cu varsta medie 49.2 ± 10.9 ani), netratati anterior. Majoritatea subiectilor recrutati prezinta viremii VHC inalte – valoarea medie a incarcarii virale initiale a fost de 2.4 ± 2.9 x 106 UI / ml (6.1 log UI/ml); numai 28.9% dintre pacienti au avut initial viremie VHC mai mica de 400.000 UI/ml.  A fost analizata prevalenta si polimorfismului regiunii rs12979860 din vecinatatea genei pentru IL28B la pacientii infectati VHC inclusi in studiul HepGen si efectul asupra raspunsului precoce la tratament Testarea s-a realizat prin reactia de discriminare alelica – Custom TaqMan Single Nucleotide Polymorhism Genotyping Assays (Applied Biosystem), pornind de la  ADN-ul genomic purificat din sange integral, conform protocolului optizat in etapa1.  Rezultatele preliminare indica faptul ca majoritatea pacientilor sunt heterozigoti CT (64.4%), in timp ce  homozigotismul este distribuit egal (17.8% CC si 17.8 % TT).  Rate semnificativ mai mari de RVR au fost obtinute la pacientii cu genotipul CC al IL28B (38.5% vs. 8.5%  dintre cei cu genotip CT, p=0.005). Polimorfismul IL28B este, de asemenea, asociat cu rate diferite de evolutie spre ciroza hepatica a pacientilor homozigoti CC fata de pacientii cu genotip heterozigot CT sau homozigoti TT, iar procentul scazut de homozigoti CC din studiul nostru (17.8% CC) ar putea indica o populatie cu multipli factori de predictie negativa.

Stabilirea unui protocol de lucru pentru analiza markerilor de rezistenta la noile tratamente antivirale

În mai 2011, Food and Drug Administration (S.U.A.) a aprobat utilizarea a doua noi antivirale din categoria DAA (“direct acting antivirals”). Cei doi compuşi peptidomimetici, telaprevir şi boceprevir, acţionează direct asupra complexului proteazic viral NS3-NS4A legându-se la centrul catalitic activ. Compuşii nu pot fi folosiţi individual ci doar în combinaţie cu interferonul alfa şi  ribavirina. Acest lucru este justificat de emergenţa rapidă a mutaţiilor de rezistenţă la noile chimioterapeutice. Utilizarea triplei terapii interferon alfa, ribavirină şi telaprevir/boceprevir creşte rata obţinerii răspunsului susţinut la genotipul 1 la aproximativ 70% dintre pacientii tratati. Telaprevir şi boceprevir induc selecţia şi expansiunea rapidă a unor populaţii virale minore ce prezintă rezistenţă  la aceste antivirale. Au fost descrise numeroase mutaţii localizate în regiunea codificatoare NS3 ce conferă grade diferite de rezistenţă la inhibitorii de protează: V36, T54, T55, R155, A156, V170 şi altele.  Terapia cu inhibitori de protează nu este încă introdusă ca tratament standard în România (ci doar pe loturi mici de pacienti, in studii clinice) si nu se cunoaşte profilul de rezistenţă la aceste chimioterapeutice a variantelor HCV circulante la pacienţii din ţara noastră. Pentru atingerea acestui obiectiv, a fost studiată regiunea NS3 protează prin secvenţierea directă. Au fost selectaţi pacienţi cu hepatită cronică cu virus C subtip 1b din lotul retrospectiv furnizat de partenerul 1 (Spitalul V. Babes). In Institutia coordonatoare (IC) ARN viral a fost extras din 140 µL ser utilizand kitul comercial QIAamp Viral Mini Kit (Qiagen). Reverstranscrierea genomului HCV s-a realizat utilizând primeri „random hexamers” (Promega) şi AMV RT (Avian Myeloblastosis Virus Reverse Transcriptase, Promega. Secvenţierea directă a ampliconilor am realizat-o cu kitul BigDye Terminator v3.1 (Applied Biosystems) conform instrucţiunilor producătorului. Fragmentele rezultate în urma reacţiei de secvenţiere au fost analizate prin electroforeză capilară (3130 Genetic Analyzer, Applied Biosystems). Analiza moleculară a regiunii NS3 protează. Pentru 18 din cele 24 probe ser analizate s-a obţinut un amplicon de dimensiunea aşteptată. Analiza mutaţională a întregului domeniu proteazic NS3 (181 amino-acizi) pentru cele 18 probe secvenţiate a relevat existenţa mutaţiei I132V la 12 pacienţi. ). In vitro, această substituţie conferă o rezistenţă scăzută la telaprevir (creştere de 2 ori a concentraţiei eficiente medie [EC50]) (Wyles DL, 2012). Este de menţionat că pacienţii înrolaţi în acest studiu nu au fost trataţi cu telaprevir/boceprevir, în Romania aceste două antivirale nefiind incluse în schema standard de tratament. Celelalte probe nu prezintă mutaţii de rezistenţă la inhibitorii de proteaze (Fig 1).

 

Studiul epidemiologic al factorilor genetici si non-genetici responsabili pentru esecul terapeutic (P1, P2)

P1 (SVB): Recrutarea de pacienti

In cursul anului 2013 au fost recrutati un numar total de 87 pacienti in cadrul Spitalului Victor Babes (SVB). Activitatile legate de recrutare au constat in: informarea pacientilor propusi pentru recrutare despre studiul in care sunt recrutati pentru obtinerea consimtamantului acestora, cu semnarea formularului de consimtamant informat, completarea chestionarelor de recrutare, introducerea in baza de date a studiului a datelor de chestionar si a rezultatelor investigatiilor biologice de ingrijire standard, prelevarea de produse biologice conform protocolului elaborat in etapa I a proiectului, efectuarea testului de incarcatura virala la initierea tratamentului, efectuarea si trasferarea stocurilor de sange si ser catre parteneri si coordonator. Pacientii au beneficiat de ingrijiri standard si investigatii suplimentare suportate de bugetul proiectului. Dintre investigatiile efectuate din bugetul proiectului, in laboratorul spitalului s-au efectuat incarcaturile virale de initiere a tratamentului (T0), tuturor pacientilor, si cea de la saptamana S04, doar pacientilor carora nu le-a fost prevazuta prin ingrijiri standard. Efectuarea testului de incarcatura virala la saptamana 4 de tratament  este inclusa in ingrijirile standard pentru acei pacienti care au avut incarcatura virala de la aprobarea dosarului de tratament peste valoarea de 600.000 UI/mL. Incarcaturile virale din bugetul proiectului au fost efectuate pentru pacientii recrutati la ambii parteneri care au efectuat recrutari in cadrul studiului. Activitatile de monitorizare au constat in consemnarea reactiilor adverse si a rezultatelor investigatiilor biologice si virusologice. Aprecierea raspunsului virusologic la 3 luni de tratament ca predictor al RVS este facuta in mod standard utilizand pragul de 2 log UI/mL de reducere a incarcaturii virale. In analizele noastre pe un lot de 72 pacienti care au fost evaluati la S12, pragul de 3 log este superior ca semnificatie statistica fata de cel de 2 log in separarea pacientilor pe criterii imunologice si genetice umane si virale (genotip HCV, prezenta markerilor de rezistenta la tratament in genomul HCV).

Pe parcursul  etapei, Institutul Clinic Fundeni (P2) a evaluat 26 de pacienti cu infectie cronica VHC la care s-a initiat tratament cu Peginterferon (α2a sau α2b) si Ribavirina („standard of care” pentru infectia VHC in Romania, la momentul actual) si care au indeplinit conditiile stabilite in cadrul consortiului in prima etapa a proiectului de cercetare. Toti pacientii au semnat Consimtamantul Informat pentru participarea la acest proiect de cercetare. Pacientii au fost evaluati la momentul initierii tratamentului prin stabilirea cat mai exacta a duratei infectiei VHC, evaluarea posibililor factori de risc in ceea ce priveste modalitatea de infectare, precizarea  datelor demografice, stabilirea comorbiditatilor, efectuarea  examenului fizic (inclusiv calcularea IMC) si recoltarea probelor biologice (pentru efectuarea  testelor  biochimice uzuale, lucrate in cadrul laboratorului local, si pentru efectuarea testelor speciale stabilite in cadrul consortiului. De asemenea, pacientii au fost evaluati ecografic si prin efectuarea Fibroscan (ca si metoda non invaziva de evaluare a fibrozei hepatice). Evaluarea non-invaziva prin Fibroscan a fost efectuata si pentru o serie de pacienti, participanti in cadrul proiectului HepGen , evaluati si urmariti  de catre partenerul P1.

Dupa initierea tratamentului antiviral, pacientii au fost evaluati la saptamana 4 si 12 (examen clinic, bilant biologic, determinare ARN-VHC, prezenta efectelor adverse, evaluarea tolerantei si aderentei pacientilor la tratament). In saptamana 24 de tratament, pacientii au fost evaluati clinic si prin teste biochimice uzuale, precum si din punct de vedere al efectelor adverse. Pacientii care nu au prezentat EVR, au fost evaluati si prin determinarea incarcaturii virale. Din cei 26 pacienti recrutati in cadrul IC Fundeni, repartitia pe sexe a fost relativ egala (14 femei, 12 barbati), varsta medie fiind 58,83 ani. La initierea biterapiei, 12 pacienti au prezentat valori ale viremiei VHC < 800000 UI/ml. 16 pacienti au fost naivi din punct de vedere al tratamentului antiviral, 10 pacienti fiind retratati. Din punct de vedere al fibrozei (evaluata non-invaziv prin Fibroscan), 2 pacienti au avut F0, 6 pacienti-F1, 8 pacienti-F2, 3 pacienti-F3, 7 pacienti-F4. Din numarul total de pacienti, 2 pacienti au intrerupt tratamentul din proprie initiativa, in saptamana 3 (datorita efectelor adverse altele decat hematologice, respectiv astenie fizica majora, tuse severa). Din cei 26 de pacienti, 4 pacienti (15,4 %)  au prezentat viremie nedetectabila la saptamana 4 de tratament (RVR)  si 11 pacienti (42,3%) au fost cu incarcatura virala nedetectabila dupa 12 saptamani de tratament antiviral. Ca si efecte adverse, pacientii au prezentat anemie (6 pacienti au prezentat anemie grad 1 si 6 pacienti au prezentat anemie grad 2), un pacient prezentand anemie grad 3, care a aparut in saptamana 11 de tratament si care a necesitat administrarea de masa eritrocitara si scaderea dozelor de Ribavirina). Din cei 26 de pacienti  urmariti, 7 pacienti au prezentat trombocitopenie grad 1 iar la 5 pacienti, trombocitopenia a fost de grad 2. Doi pacienti au prezentat neutropenie grad 1 si un pacient a necesitat reducerea temporara a dozei de Peginterferon datorita neutropeniei de grad 3 (aparuta in  cursul saptamanii 40 de tratament) (efectele adverse au fost gradate folosindu-se criteriile DIADS).

Studiul markerilor genetici umani ITPA si HLAB27 realizat de Partenerul 4 (PG)

      Lotul de studiu a fost constituit din 100 de pacienti infectati cu HCV, care au intrunit toate criteriile de selectie stabilite de consortiul partenerilor.   Studiul markerului genetic HLA-B27 a fost bazat pe metodologia multiplex PCR si hibridizare inversa (revers-hibridizare), fiind realizat cu ajutorul kitului IVD GenoQuick HLA-B27 (HAIN), conform recomandarilor producatorului si descrisa amanuntit in raportul anterior. Testarea moleculara in vederea detectiei grupului de alele HLA-B27 prin metoda utilizata a permis identificarea cu acuratete in probele analizate a urmatoarelor alele din grupul HLA-B27 (conform specificatiilor producatorului): *02, *03, *04, *05, *06, *07, *08, *09, *10, *11, *12, *13, *14, *15, *16, *17, *19, *20, *21, *24, *25, *27, *28, *30, *32, *33, *34, *35 si *36.

 

Cele doua polimorfisme din gena ITPA analizate au o frecventa relativ crescuta in populatia umana. Frecventa alelei minore (A) corespunzatoare polimorfismului ITPA 94C>A (rs1127354) raportata in baza de date SNP Database este de 0.081, iar in cazul polimorfismului IVS2 + 21 A>C (rs7270101) frecventa alelei minore C este de 0.074 (SNP Database, National Center for Biotechnology, accesat 22.10.2013). Datele obtinute de noi in lotul de 100 de pacienti infectati cu HCV sunt comparabile cu datele raportate in literatura. Reducerea activitatii enzimei ITPA poate reduce severitatea anemiei in grade diferite, in functie de polimorfismele existente in gena ITPA. Astfel prin realizarea acestui test molecular predictiv se poate realiza selectia pacientilor cu risc de anemie la terapia antivirala (destul de agresiva) cu interferon si ribavirina, care ar putea avea nevoie de trasfuzii de sange sau administrare de eritropoetina in timpul tratamentului.

In cadrul esantionului de 100 de pacienti analizat in cadrul acestei etape a proiectului, a fost identificata prezenta alelei HLA-B27 in cazul a 6 pacienti infectati cu HCV. Prezenta unei alele HLA-B27 in pana la 8% din populatia de origine caucaziana a fost raportata in literatura, datele fiind similare cu cele obtinute de noi in acest studiu. Asociatia dintre prezenta unei alele HLA-B27 si clearance-ul spontan al HCV a fost raportata atat in populatia de origine caucaziana, cat si in cea de origine afro-americana (Neumann-Haefelin and Thimme, 2007). Monitorizarea in continuare a evolutiei pacientilor din studiul nostru va evidentia prezenta sau dimpotriva, absenta unei corelatii intre prezenta unei alele HLA-B27 si evolutia infectiei cu virusul HCV in lotul de studiu.

 

Studiul nivelului plasmatic al sCD26 (P3)

Proteina CD26 sau proteina de membrană IV este o glicoproteina de 110 kDa care functioneaza ca dipeptidil-peptidaza (DPPIV) ce cliveaza penultima prolina sau alanina de la capatul N terminal al multor peptide; inclusiv IP-10, aceasta clivare inducand pierdea activitatii chemotactice a IP-10, cu migrare scazuta a celulelor CXCR3 la nivel hepatic.

Optimizarea protocolului de lucru pentru studiul proteinei CD26 solubila

In scopul determinarii nivelului plasmatic al sCD26 am ales un test imunoenzimatic  tip sandwich cu sensibilitate crescuta, ce utilizeaza anticorpi monoclonali antiCD26 peliculizati pe suport solid si detecteaza forma solubila a proteinei cu ajutorul unor anticorpi policlonali conjugati cu biotina. Dupa adugarea substratului streptavidina –peroxidaza formeaza un produs colorat direct proportional cu cantitatea de sCD26 prezent in proba. Detectia cantitativa se realizeaza cu o curba standard, ce include 6 concentratii cunoscute de sCD26 (Fig 3). Probele de ser selectate aleatoriu de la donatori sanatosi testate pentru sCD26 au indicat valori variind intre 296- 1110 ng/ml, cu o medie de 591±179 ng/ml. Limita de detectie a testului este de 7.3 ng/ml sCD26.

In aceasta etapa am testat  83 de pacienti infectati VHC inclusi in studiu, pentru nivelul plasmatic al sCD26 ; rezultatele preliminare indica o valoare medie inalta la initierea terapiei:810 ± 285 ng/mL (120-1650 ng/mL). Valoarea baseline a proteinei sCD26 se coreleaza statistic semnificativ cu valoarea incarcarii virale ARN VHC la debutul terapiei, valoarea transaminazei ALT si procentul de homozigoti CC al IL28B in rs12979860 (cu semnificatie prognostica favorabila), si relativ semnificativ cu gradul de fibroza hepatica evaluata prin testul Fibroscan.

Secventierea integrala a ORF-ului HCV prin electroforeza capilara si o tehnica „next generation” (Co, P4)

Tehnicile de mare randament permit obținerea rapidă a secvențelor unui număr foarte mare de fragmente relativ scurte (30 – 400 baze) de ADN, într-un singur experiment de acest tip putând fi “citite” 0,4 – 30 miliarde de baze, în funcție de platforma utilizată. Volumul mare de informații astfel obținute permite descoperirea unor variante rare virale, identificarea unui număr mare de mutații și estimarea mai exactă a diversității virale prin analiza cvasispeciilor prezente la nivelul unei gazde. Datorită lungimii mai mari a fragmentelor citite, platforma de pirosecvențare 454/Roche permite asamblarea fragmentelor în genomuri complete, chiar daca numărul total al nucleotidelor citite este mai mic. Strategia aleasă pentru a obține ADN-ul necesar procedurii a constat în reverstranscrierea urmată de amplificarea (nested PCR) a 4 regiuni cu lungimi de aproximativ 2500 baze ce acoperă aproape întregul genom (9388 de baze din cele aproximativ 9600 care formează cadrul de citire – ORF, și regiunile netraduse de la capetele 5′ și 3′ – UTR), conform Yao E, 2005. Cei patru ampliconi obținuți de la fiecare pacient au fost apoi fragmentați aleator prin nebulizare, iar la capetele fragmentelor astfel obținute au fost apoi ligați adaptori ce permit amplificarea ulterioară în emulsie și secvențarea. Utilizarea metodei de ligare a unor adaptori la fragmentele bibliotecii permite multiplexarea reacției, fără a fi necesară secvențarea separată a ampliconilor proveniți de la cazuri diferite, prin utilizarea unor “etichete moleculare” (molecular IDs – MIDs) secvențe unice de 10 nucleotide incorporate în adaptori ce vor fi identificate automat de programul de secvențare.

Luând în considerare numărul de 400 milioane de baze ce pot fi citite într-un experiment folosind sistemul 454, lungimea de aprox. 10.000 baze a fragmentelor obținute de la fiecare pacient și numărul de 12 cazuri, rezultă o acoperire medie teoretică de aprox. 3333 ori a fiecărei poziții din genomul HCV. Această acoperire permite detecția variantelor uninucleotidice cu frecvență mai mare de aprox. 3% folosind instrumentele de analiză incluse în sistem (Amplicon Variant Analyzer), sau poate oferi o sensibilitate chiar mai mare (până la frecvențe mai mici de 1%) folosind instrumente software mai noi precum LoFreq, SNVer sau V-Phaser. Sensibilitatea metodei depinde însă de rata de eroare a procesului, datorată în special erorilor introduse de amplificarea PCR și a celor datorate pirosecvențării (homopolimeri, degradarea performanțelor peste o lungime de aprox 350 baze). Prin urmare, pentru a estima eroarea generală asociată metodei utilizate, am inclus în experiment și un genom HCV de control, constând în cDNA al unui izolat de HCV 1b (Con1), clonat în plasmidul pFK, a cărui secvență este cunoscută.

Lotul de studiu. Cei 11 pacienți incluși în acest experiment au fost selectați de partenerii de la Institutul Cantacuzino. Controlul pFK-Con1 a fost obținut prin amabilitatea prof. Ralf Bartenschlager, Univ. Heidelberg.

Prepararea bibliotecilor. Extracția ARN viral din ser, reverstranscrierea in cDNA si amplificarea PCR au fost realizate de catre Co, in Institutul Cantacuzino. Reverstranscrierea a fost realizată folosind primeri specifici, iar amplificarea a fost realizată utilizând PCR în două etape (nested PCR), cu primeri conținând poziții ambigue. Benzile de interes obținute au fost excizate din gel, purificate și produsul cuantificat prin fluorimetrie (sistem Qubit și kituri High-Sensitivity dsDNA). Dimensiunile fragmentelor au fost analizate prin electroforeză microcapilară, folosind sistemul Bioanalyzer 2100 și kituri High Sensitivity DNA de la Agilent. Ampliconii astfel obținuți au fost amestecați echimolar pentru fiecare pacient / control, astfel încât cantitatea totală de ADN să fie mai mare de 500 ng pentru fiecare reacție. Amestecurile de ampliconi au fost apoi fragmentate prin nebulizare cu azot sub presiune, produsul fiind purificat prin elutie pe coloane DNA MinElute (Qiagen). În conformitate cu protocolul producătorului (Roche Rapid Library Preparation Kit), a urmat apoi o etapă de reparare enzimatică a capetelor fragmentelor obținute și ligarea adaptorilor ce includ etichetele MID și sunt marcați fluorescent. Moleculele ADN cu dimensiuni mari de 100 pb au fost selectate prin adsorbție pe microparticule magnetice AMPure XP (Agencourt, Beckman Coulter). Bibliotecile astfel preparate au fost cuantificate prin măsurarea fluorescenței incorporate folosind un sistem Infinite M200 Pro cu placa pentru volume mici Nanoquant (Tecan), realizându-se apoi pentru fiecare probă o diluție stoc de 1 x 107 molecule /  microL. De asemenea, mărimea fragmentelor ce compun bibliotecile a fost analizată folosind electroforeza microcapilară. În final, cantități egale de fragmente provenind de la fiecare probă au fost amestecate, realizându-se astfel biblioteca finală pentru secvențare.

Amplificarea în emulsie. Următorul pas a constat în amplificarea clonală a fragmentelor de ADN, prin capturarea moleculelor de ADN pe microsfere de captură și includerea acestora în picături de mediu de reacție emulsionate în ulei. Urmează o etapă de PCR ale cărei recții se desfășoară clonal în interiorul picăturilor (emPCR). După amplificare, microsferele sunt recuperate din emulsie, iar cele care au găzduit o reacție eficientă de amplificare sunt selectate prin utilizarea de bile magnetice.

Secvențarea și analiza preliminară a datelor. În această etapă am utilizat ambele regiuni ale unei plăci de reacție PicoTiter (Roche), pe care am încărcat microsferele cu ADN. Kitul de reactivi utilizat a fost XLR70 Titanium Sequencing Kit. Datele brute (imaginile) au fost achiziționate folosind software-ul dedicat al sistemului, iar analiza de imagine a fost realizată pe computerul secvențatorului. Procesarea ulterioară a datelor a fost realizată pe un computer de tip cluster (Roche Titanium Cluster – 5 noduri de procesare, 20 procesoare, 32 GB memorie), folosind programul sistemului (gsRunProcessor) și algoritmul destinat analizei secvențelor obținute prin metoda shot-gun. A fost realizat un control de calitate al secvențelor pbținute folosind programul GS Run Browser (Roche). Analiza preliminara a datelor a fost realizată utilizând programul GS Reference Mapper (Roche) și a constat în asamblarea secvențelor citite în fragmente mai lungi (contigs), urmată apoi de compararea acestora cu secvența de referință a izolatului HCV Con1.

Bibliotecile realizate prin ligare au fost cuantificate folosind o curbă standard de fragmente cu concentrații cuprinse între 25 și 1,42 x 108 molecule / microL Rezultatele au fost reproductibile și conforme așteptărilor, pentru toate cazurile preparate obținându-se concentrații între 7 și 20 x 108 molecule / microL. Din punct de vedere al dimensiunii fragmentelor ce formează bibliotecile produse prin nebulizare, rezultatele au fost corespunzătoare tehnic cerințelor protocolului. Astfel, toate probele au generat fragmente cu dimensiunea medie între 500 și 900 bp, mai puțin de 10% din fragmente având lungimi mai mici de 350 bp. În urma filtrării pe baza unor criterii de calitate a rezultatelor brute, au rezultat 1.069.542 de secvențe totalizând 424.886.322 baze. Aceste rezultate sunt concordante cu rezultatele citate în literatura de specialitate, ceea ce califică experimentul de secvențare în categoria celor reuțite din punct de vedere tehnic.

 

În concluzie, rezultatele obținute în această etapă a proiectului se ridică, din punct de vedere calitativ și cantitativ, la nivelul propus în faza de design experimental. Ele vor permite analiza ulterioară a diversității genetice a HCV și identificarea unor mutații cu relevanță clinică.

Determinarea incarcaturii virale pre/post-tratament la 4, 12, 24/48 saptamani si la sase luni dupa tratament (P1)

Analiza raspunsului la tratament exprimat ca reducere a nivelului replicarii virale (SVB)

Incarcatura virala in sangele periferic este un indicator standard pentru evaluarea replicarii virale. Testarea acesteia este principalul indicator si predicitor al succesului terapeutic. Pentru evaluarea incarcaturii virale am utilizat doua metode bazate pe real-time PCR, ambele complet automatizate: Cobas Amplicor Cobas TaqMan (CAP-CTM), Roche si m2000 RealTime, Abbott. Cele doua teste au fost utilizate cu reactivi specifici, fiecare sistem fiind un sistem inchis. Toate testele atat cele specifice studiului (T0 si S04) cat si cele din cadrul ingrijirilor standard, au fost realizate cu metoda CAP-CTM, in timp ce unele probe (n=20) au fost testate cu ambele metode pentru a observa diferentele. In cursul studiului, la inceputul anului 2013, producatorul Roche a pus in vanzare exclusiv un test nou, avand modificat design-ul molecular, astfel incat s-au utilzat pentru monitorizarea pacientilor doua versiuni de test in mod succesiv. Evaluarea paralela pe aceleasi probe a celor doua versiuni CAP-CTM si a testului RealTime m2000 a aratat diferente <0.5 log UI/mL atat intre cele doua versiuni CAP-CTM cat si intre CAP-CTM v2.0 si m2000 Abbott, cea din urma fiind introdusa in martie 2013.

 

 

 

Proiect 88/2012 HepGen

Raport stiintific si tehnic

 

Etapa III

1 decembrie 2013 – 31 octombrie 2014

Corelatii intre factorii virali, ai gazdei si de mediu implicati in progresia bolii si emergenta rezistentei la antivirale

 

 

 

Lotul de studiu al proiectului a fost completat in aceasta etapa cu 107 pacienti infectati cu HCV, care au intrunit criteriile de selectie stabilite de consortiul partenerilor. Astfel, lotul de pacienti la care au fost studiati markerii genetici umani HLA-B27 si ITPA din cadrul acestui proiect a fost de 207 pacienti infectati cu HCV in faza cronica.  In cursul anului 2014, pana la 01Oct2014, au fost recrutati un numar total de 74 pacienti in cadrul Spitalului Victor Babes (SVB) pentru care s-au efectuat testari si stocuri. S-a efectuat monitorizarea in cursul tratamentului standard al hepatitei virale cronice de tip C pentru totalul de 180 pacienti aflati in tratament sau in perioada de urmarire conform protocolului. Au fost efectuate un total de 130 teste de incarcatura virala HCV, pentru pacientii SVB. Activitatile de monitorizare au constat si in consemnarea reactiilor adverse si a rezultatelor investigatiilor biologice si virusologice:

–         Raspunsul virusologic sustinul in cadrul lotului, pentru pacientii cu S72 calendaristic efectuat (N=71), este de 39,4%;

–         La fiecare moment de evaluare in cadrul protocolului (S04, S12, S24, S48), un procent de pacienti aflat intre 6,7% si 13,9%, au prezentat reactii adverse hematologice care necesita scaderea dozelor terapeutice standard sau intreuperea temporara/ definitiva a tratamentului.

Dintre investigatiile efectuate din bugetul proiectului, in laboratorul spitalului Victor Babes (P1)   s-au efectuat incarcaturile virale de initiere a tratamentului (T0), tuturor pacientilor, si cea de la saptamana S04, doar pacientilor carora nu le-a fost prevazuta prin ingrijiri standard (efectuarea testului de incarcatura virala la saptamana 4 de tratament  este inclusa in ingrijirile standard pentru acei pacienti care au avut incarcatura virala de la aprobarea dosarului de tratament peste valoarea de 600.000 UI/mL). Au fost efectuate un total de 130 teste de incarcatura virala HCV pentru pacientii SVB. Activitatile de monitorizare au constat si in consemnarea reactiilor adverse si a rezultatelor investigatiilor biologice si virusologice. Toate datele din chestionarul de initiere a tratamentului si din observatiile de monitorizare au fost incluse in baza de date electronica, conform structurii agreate de consortiu in etapele anterioare ale studiului, informatii ce au fost transferate partenerilor de consortiu la un moment de bilant in cursul anului 2014.

Analiza reactiilor adeverse la tratament: s-a urmarit centralizarea reactiile adverse hematologice gradul III, care au determinat modificarea dozelor de tratament, la toate momentele de evaluare in cadrul protocolului (S04, S12, S24, S48):

–         anemie cu hemoglobina =<10 g/ dL

–         neutropenie cu neutrofile =<750/ microL

–         trobopenie cu trombocite =<50.000/ microL

 

Din cei 26 pacienti recrutati in cadrul IC Fundeni, repartitia pe sexe a fost relativ egala (15 femei, 12 barbati), varsta medie fiind 59,07 ani. La initierea biterapiei, 12 pacienti au prezentat valori ale viremiei VHC < 800000 UI/ml. 17 pacienti au fost naivi din punct de vedere al tratamentului antiviral, 10 pacienti fiind retratati. Din punct de vedere al fibrozei (evaluata non-invaziv prin Fibroscan), 2 pacienti au avut F0, 6 pacienti-F1, 8 pacienti-F2, 4 pacienti-F3, 7 pacienti-F4. Din cei 26 de pacienti, 4 pacienti (15,4 %)  au prezentat viremie nedetectabila la saptamana 4 de tratament (RVR)  si 11 pacienti (42,3%) au fost cu incarcatura virala nedetectabila dupa 12 saptamani de tratament antiviral (EVR). 19 pacienti au obtinut RVS, au fost  7 pacienti non-responderi si 2 pacienti care au prezentat recadere la 24 saptamani post tratament antiviral.

Analiza corelatiilor datelor demografice, clinice, paraclinice cu obtinerea statusului SVR, respectiv cu non- raspunsul la tratament s-a facut prin aplicarea t-test si ANOVA (pentru variabilele continue cu distributie normala),  Mann Whitney U- test (pentru variabilele care nu au distributie normala),  Pearson chi2 test respective Fischer (pentru variabilele categoriale).

In aceasta etapa, la INCDMI Cantacuzino au fost amplificate si secventiate prin metoda clasica in gena HCV core 53 probe (25 seruri provenite de la pacienti naivi din Spitalul V. Babes si 28 seruri provenite de la Inst. Clinic Fundeni, dintr-un lot de pacienti supusi triterapiei). Analiza “in silico’ in regiunea core, realizata pe toti pacientii din lotul Hepgen (153 de tulpini analizate) a permis genotiparea si analiza celor doua pozitii mutante din gena core. Distributia genotipurilor HCV este urmatoarea: 1a – 5,2%; 1b – 91,5%; 3a – 1,96%; 4a – 1,3%. Genotipul 1b ramine majoritar dar se constata o crestere a prevalentei altor genotipuri si subtipuri, specifice utilizatorilor de droguri injectabile. Mutatia in pozitia 70 din gena core a fost prezenta in procent mai mare (56%) la nonresponderi decit la pacientii cu SVR (38,4%), distributia mutatiei 91 nu a fost semnificativa intre cele doua categorii de pacienti (68,7% la nonresponderi versus 69,2% la SVR). In schimb, ambele mutatii au fost prezente la un numar mai mare de nonresponderi decit la pacientii care au obtinut SVR (50% la nonresponderi versus 34,6% la SVR).

Pentru evaluarea profilului de rezistenţă la noile terapii cu antiproteazice a variantelor HCV circulante la pacienţii din ţara noastră la INCDMI Cantacuzino a fost studiată regiunea NS3 protează prin secvenţierea directă a probelor de la pacienti inrolati la P2  (14 seruri dintr-un lot de cu esec terapeutic la biterapie si retratati cu inhibitori de proteaza (3 pacienti tratati cu telaprevir si 11 pacienti tratati cu boceprevir). Pentru evaluarea cauzelor esecului la triterapie (telaprevir sau boceprevir si PEG-IF/ribavirina) in institutia Co (INCDMI Cantacuzino)  aceste probe au fost analizate prin PCR si secventiere capilara atit pentru mutatiile in regiunea core cit si pentru mutatiile in proteina tinta pentru terapia anti-proteazica – proteaza NS3. De asemenea, la P4 (PG) a fost evaluat profilul genetic al acestor pacienti in gena IL28B (polimorfismul rs12979860). In paralel, aceleasi investigatii moleculare au fost realizate pentru un lot control de 14 pacienti, tratati cu biterapia standard si naivi pentru triterapie. Lotul de pacienti tratati cu triterapie a prezentat un profil nefavorabil IL28B – 14,3% genotip TT si genotipul heterozigot CT in proportie de 85,7%. In lotul control, procentele au fost asemanatoare, cu predominanta genotipurilor nefavorabile pentru raspunsul la IFN/ribavirina (TT – 28,6%; CT – 64,3%). Un mic procent de pacienti a prezentat profilul favorabil CC (7,1%).  Privind genotipul viral, toti pacientii din cele doua loturi au fost infectati cu HCV genotip 1b. Mutatiile in gena HCV core (core70, core91 si ambele muatii) au fost prezente la 50% din lotul control. In schimb, in lotul de tratati cu tripla terapie, mutatiile core70 si dubla mutatie 70/91 au fost prezente la 61,5% din probele virale analizate iar mutatia core91 a fost prezenta in proportie de 92,3%. Mutatiile de rezistenta la telaprevir/boceprevir in gena virala NS3. La 4 pacienti cu recadere, tratati cu boceprevir din lotul cu tripla terapie, au fost identificate atit mutatiile de rezistenta la boceprevir: 54S, 156S cit si mutatiile de rezistenta la telaprevir (doua mutatii fiind comune pentru ambii inhibitori de proteaza): 54S, 132V, 156S. Cu exceptia a doi pacienti, mutatia 132V la telaprevir a fost detectata la toate cazurile de non-responderi si recadere la boceprevir sau telaprevir. Aceasta mutatie la telaprevir a fost prezenta si la 10 din cei 14 pacienti naivi pentru inhibitorii de proteaza.

Analiza moleculara prin secventiere next generation (tehnologia Next Gen Sequencing Roche FLX 454). P1, Co si P4  au fost implicati in selectarea unor tulpini virale pentru secventierea extinsa a genomului: 4 tulpini dintr-un lot retrospectiv de pacienti care au incheiat tratamentul – 2 cu raspuns sustinut (SVR) si 2 cu non-raspuns/recadere si 7 tulpini din lotul HepGen de la pacienti naivi pentru tratament, carora li s-a efectuat analiza virala la momentul T0, inainte de a primi prima doza din tratament.

Stabilirea corelatiilor intre markerii serologici (ITPA si HLA-B27), virali si genetici umani, determinarea incarcaturii virale pre/post-tratament la 4, 12, 24/48 saptamani si la sase luni dupa tratament si optimizarea protocolului de lucru pentru studiul SNP al markerilor genetici umani ITPA si HLA-B27 au condus la urmatoarele concluzii:

–         s-a constatat o asociere semnificativă din punct de vedere statistic (Fisher exact P=0.026) în cadrul lotului de femei între combinația de genotipuri A (wt/wt) a markerului ITPA și nivelul scăzut al hemoglobinei la săptămâna 4 de tratament. Aceasta semnificatie statistica nu s-a mai regasit la saptamana 12 in lotul de pacienti de sex feminin studiat (P=0.1467); nu s-a observat asociere semnificativa statistic intre nici o combinatie de genotipuri ITPA si nivelul scazut de hemoglobina în cadrul lotului de pacienți de sex masculin (P=0,12);

–         prezenta grupului aleleic HLA-B27 a fost detectata la 5,31 % pacienti cu HCV din lotul studiat, rezultat semnificativ statistic diferit de  prezenta acestui grul allelic HLA in populatia romaneasca generala (p=0.0470);

–         Analiza statistica a relatiei dintre prezenta grupului de allele HLA-B27 si raspunsul RVR al pacientilor din cadrul esantionului nostru nu a evidentiat diferente semnificative statistic intre esantionul de pacienti cu RVR la care a fost detectata alela HLA-B27 si la care nu a fost detectata alela HLA (p=0.28004).

 

 

Proiect 88/2012 HepGen

Raport stiintific si tehnic

 

Etapa IV

1 noiembrie 2014 – 31 decembrie 2015

Implementarea algoritmului de predictie a non-responderilor la tratamentul antiviral

 

Rezumatul etapei

 

La P1 s-a efectuat colectarea si stocarea, respectiv transferul probelor biologice spre partenerii din consortiu, conform protocolului agreat.  S-a continuat completarea bazelor de date  cu informatii ale pacientilor si rezultatele investigatiilor efectuate in cadrul spitalului. Din totalul de 190 pacienti recrutati in cadrul studiului de catre SVB, 52 au rezultat nedetectabil la 6 luni dupa terminarea tratamentului de 48 sau 24 saptamani  (29.9%). Din datele obtinute in cursul acestei etape, 11 pacienti au obtinut RVS, au fost  5 pacienti non-responderi si 5 pacienti care au prezentat recadere la 24 saptamani post tratament antiviral  Partenerul 2 a contribuit la elaborarea unui ghid privind tratamentul hepatitei cu virus C in tarile Comunitatii Europene.

In ceea ce priveste studiul profilului markerilor genetici si virali asociati cu evolutia tratamentului Partenerul 2 impreuna cu Coordonatorul au analizat mutatiile de rezistenta la telaprevir/boceprevir in gena virala NS3 iar P4 a analizat profilul IL28B la acesti pacienti.  Genotipul IL28B CT, care este si genotipul mai putin favorabil, este predominant în populația analizată.  Mutatia Core R70Q este prezentă în mai mult de jumatate dintre pacientii tratati in timp ce mutatia core L91M a fost prezent la aproape toti pacientii. Ambele mutatii de rezistenta la boceprevir: 54S, 156S si mutatiile  de rezistenta la telaprevir: 54S, 132V, 156S au fost găsite la 4 pacienti cu recadere tratati cu tripla terapie (boceprevir/IF/Rv).  Mutatia la telaprevir 132V a fost detectat la pacioentii cu recadere sau non-raspuns la tripla terapie.  Un singur pacient nu a prezentat nici o mutatie de rezistenta in proteaza virală NS3. Zece din cei 14 pacienți naivi pentru inhibitorii de protează, tratați cu interferon pegylat si ribavirina, au prezentat mutatia  la telaprevir 132V. Eșecul tratamentului la terapia triplă cu antiproteazice (boceprevir sau telaprevir)  pare a fi corelat cu sensibilitatea pacientilor la interferon și de preexistenta variantelor  rezistente.

In aceasta etapa, la INC Cantacuzino (Co) au fost amplificate si secventiate prin metoda clasica in genele HCV core si NS3 60 de probe. Analiza “in silico’ in regiunea core, realizata pe toti pacientii din lotul Hepgen (158 de tulpini analizate) a permis genotiparea si analiza celor doua pozitii mutante din gena core. Genotipul 1b ramine majoritar dar se constata o crestere a prevalentei altor genotipuri si subtipuri, specifice utilizatorilor de droguri injectabile. Mutatia in pozitia 70 din gena core a fost prezenta in procent mai mare (56%) la nonresponderi decit la pacientii cu SVR (38%), distributia mutatiei 91 nu a fost semnificativa intre cele doua categorii de pacienti (70% la nonresponderi versus 69% la SVR). In schimb, ambele mutatii au fost prezente la un numar mai mare de nonresponderi decit la pacientii care au obtinut SVR

In etapa 4, Partenerul 3 (IVN) a fost implicat individual sau impreuna cu coordonatorul proiectului si ceilalti parteneri ai consortiului in determinarea raspunsului virusologic sustinut ca marker al eficientei tratamentului si evaluarea impactului markerilor virusologici asupra  raspunsului la tratament, in evaluarea unor markeri genetici si celualari ca predictori pentru aparitia efectelor adverse si raspunsului la tratament.  In lotul analizat  exista un procent extrem de scazut de pacienti homozigoti CC in gena IL28B (15.1%), profil confirmat ca predictor al evolutiei favorabile, fiind asociat cu obtinerea răspunsului virusologic rapid, a răspunsului virusologic timpuriu si a răspunsului virusologic sustinut. In analiza univariata pacienţii cu răspuns virusologic sustinut au varste semnificativ mai mici,  provin mai ales din mediul urban, au polimorfism CC al IL28B si valori scazute proteinei IP-10 serice la momentul initierii terapiei. De asemenea, acesti pacienti au avut valori reduse semificativ ale incarcarii virale baseline si raspuns virusologic favorabil la 4 si 12 saptamani de tratament  (RVR, respectiv EVR). Privind studiul unui nou marker celular, expresia miR-125b pare a se asocia cu aparitia EVR si SVR, pacientii care prezinta supresia replicarii virale la 12 saptamani de la initierea tratamentului si la 6 luni de la oprirea acestuia au valori mediane ale miR-125b mai mici – 28.75, comparativ cu pacientii ce nu obtin raspuns virusologic – 30.28.

În această etapă, Personal Genetics (P4) a obținut următoarele rezultate:

  • Centralizarea datelor privind genotipul pacienților din lotul de studiu pentru polimorfismul rs12979860 situat în apropierea genei IL28B;
  • Extinderea testării genotipului ITPA (rs1127354 și rs7270101) până la un număr total de 217 pacienți, dintre care 86 au fost incluși în baza de date ce a stat la baza elaborării algoritmului de predicție;
  • Finalizarea testării HLA-B27 în lotul de studiu
  • Analiza corelației dintre haplotipurile virale identificate prin pirosecvențiere (secventiere next generation) și răspunsul la tratament al unui număr de 11 pacienți
  • Centralizarea informațiilor privind datele demografice, markerii genetici și serologici ai gazdelor, genotipul viral și răspunsul la terapie al pacienților într-o bază de date unitară. Pe baza informațiilor menționate au fost elaborate câteva variante de algoritm de predicție a răspunsului la terapie, fiind ulterior selectată varianta cu cea mai mare putere de predicție. Algoritmul rezultat este în curs de a fi mplementat sub forma unei aplicații software.

Prin rezultatele obtinute de consortiu in aceasta etapa se impune necesitatea utilizarii unui algoritm de predictie a raspunsului la terapie, atat la cea clasica, cu Interferon/ribavirina cit si la noile terapii, bazate pe antivirale combinate.

In concluzie, toate activitatile prevazute in planul de realizare au fost indeplinite integral.

 

 

Indicatori de proces si de rezultat

Indicatori de proces

Numarul de proiecte realizate in parteneriat international: Partenerul 3  a continuat  colaborarea cu Baylor College of Medicine, Houston, Texas, in cadrul proiectului BIPAI (Baylor International Pediatric AIDS Initiative) 5P30 AI036211-20, in domeniul detectiei factorilor virali implicati in evolutia infectiilor cu virusuri hepatitice si HIV- pana la data de 31.08.2015

Indicatori de rezultat

 

CO

1. Sorin Dinu, Petre-Iacob Calistru, Emanoil Ceauşu, Gratiela Târdei, Gabriela Oprişan. Screening of Protease inhibitors resistance mutations in Hepatitis C  Virus isolates infecting Romanian patients unexposed to triple therapy. Roumanian Archives of Microbiology and Immunology, p 7-17, nr. 1-2 2015.

 

2. Teza de doctorat sustinuta de CS biochim. Sorin Dinu in 27.11.2015 la Universitatea Bucuresti, Facultatea de Biologie.

Teza cu titlul: Studii genomice și eco-epidemiologice ale unor virusuri din familia Flaviviridae a fost realizata la institutia coordonatoare INC Cantacuzino, Laboratorul de Epidemiologie Moleculara si a fost finantata partial din proiectul HepGen.

 

 

 

P2

–          Domnul Profesor Mihai Voiculescu a participat la mai multe intalniri internationale care au avut ca subiect virusurile hepatitice (The International EASL  Liver Congress– Viena 22-26 aprilie 2015, The Liver Meeting AASLD– 13-17 noiembrie 2015- San Francisco, United European  Gastroenterology Week –UEGW– 24-28 octombrie 2015- Barcelona). In 12-13 ianuarie 2015 , Domnul profesor Mihai Voiculescu a participat la Paris Hepatitis Conference unde a sustinut lucrarea”Comment optimiser le treatament des malades naifs?”

–          Domnul Profesor Mihai Voiculescu a facut parte din grupul de experti internationali care au elaborat in 2015 „ Implementation Guide on Viral hepatitis Policies for the European Union Member States”

–          In perioada  23-26 septembrie 2015, la Hotelul Pullman Bucuresti, partenerul P2 a organizat  Al XXV –lea Congres National de Hepatologie, Al V-lea Congres de Hepatologie Romano-francez si al VI-lea Curs Balcanic de Hepatologie, cu participare nationala si internationala. Manifestarea a fost creditata cu 13 ore EMC.

In cadrul acestei  manifestari, Dr Eugen Radu (P4) a sustinut lucrarea “ Investigation of hepatitis C virus genome variability by next-generation sequencing”.

 

P3

Pentru diseminarea rezultatelor legate de implicarea factorilor virali si genetici in evolutia posterapeutica a pacientilor cu hepatita cronica C, partenerul 3 a sustinut prezentarea orala:

  1. 1.  Camelia Sultana, Gabriela Oprişan, Sorin Dinu, Monica Delia Teleman,  Adelina Rosca, Cristiana Oprea, Emanoil Ceausu, Simona Ruta. Core genomic mutations and IL28b polymorphism predict the treatment outcome in patients with hepatitis C, The 9thth Balkan Congress of Microbiology, Thessaloniki, Greece, October 22-24,  2015, O24, publicat in revista  Acta Microbiologica Hellenica, 60 (3),  2015, pg 157.

 

  1. 2.   P3 a trimis spre evaluare un manuscris asupra valorii predictive a markerilor serici si genetici in raspunsul virusologic sustinut in hepatita C cronica: “The predictive value of IP-10 and IL28B on the treatment outcome in chronic hepatitis C”, autori: Camelia Sultana, Gabriela Oprişan, Camelia Grancea, Monica Delia Teleman,  Cristiana Oprea, Simin Florescu,Sorin Dinu, Emanoil Ceausu, Simona Ruta – la revista “Gastroenterology Review”, cotata ISI.

 

 

Etapa V

1 ianuarie -31decembrie 2016

Implementarea algoritmului de predictie a non-responderilor la tratamentul antiviral

 

Rezumatul etapei

 

In institutia coordonatoare (Co) s-a facut un studiu molecular cu scopul de a detecta mutațiile de rezistență la antivirale a izolatelor virale prelevate de P1 de la pacienți naivi pentru tratamentul cu inhibitori de protează virală. Virusurile au fost genotipate prin PCR si secventiere in gena core, conform unui protocol dezvoltat de grupul nostru de cercetare. Am analizat prin secvențierea populaționala și clonare moleculară si gena care codifica proteaza NS3 a virusului hepatitei C de la pacienți care care nu au fost expuși anterior la boceprevir și telaprevir. Toate probele analizate au fost subtipul 1b și sunt apropiate filogenetic de virusuri izolate de la pacienti din Romania. La acest lot se remarcă frecvenţa mai mare a mutaţiei din poziţia 91 faţă de cea din poziţia 70 in gena core.Atât secvențierea populației cit și clonarea moleculară in gena NS3 (tinta inhibitorilor de proteaza), urmată de secventiere au relevat două mutații de rezistență la boceprevir (T54S și V55A), respectiv, o mutație de rezistență telaprevir (T54S) în secvențele obținute de la un pacient cu hepatită cronică C. Prin aceste studii am identificat mutații care conferă rezistență scăzută sau medie pentru antiproteazice de prima generatie la pacienti naivi pentru acest tip de tratament.

Acest studiu indica riscul ca mutatiile la antiproteazice (de prima generatie sau DAAs)  la pacientii naivi pot sa conduca la rezistenta atunci cind se aplica tratamentul cu aceste antivirale.

In cadrul reuniunii cu consortiul HepGen, organizata de CO in 5.07.2016, s-au discutat urmatoarele: planul de realizare 2016; algoritmul de predictie; depunerea cererii de brevet; manual de management al tratamentului in hepatita cronica C; publicatii;  idei pentru exploatarea rezultatelor obtinute in cadrul proiectului.

Cercetarea clinica a partenerului SVB (P1) in cadrul proiectului Hepgen, a permis intocmirea unei baze de date valoroase, cu numerosi indicatori clinici si paraclinici care s-au dovedit utili si pot fi in continuare foarte valorosi in diverse analize si corelatii cu factori de rezistenta, factori de prognostic si alte aspecte privind managementul pacientului cu infectie cronica virala VHC.

Partenerul 3 a contribuit la identificarea profilului markerilor genetici asociati cu evolutia tratamentului si studiul factorilor virali responsabili pentru esecul terapeutic si la definirea algoritmului de predictie a non responderilor la tratamentul antiviral clasic pentru selectia pacientilor candidati pentru tratamente Interferon-free. P3 a completat baza de date cu rezultatele legate de polimorfismele genetice IL28B, nivelul IP10, si sCD26 determinate pentru toti pacientii inrolati in studiu si a realizat, impreuna cu coordonatorul proiectului, P4 si ceilalti parteneri, analiza integrata a acestora. Per ansamblul lotului, rata de succes terapeutic a fost foarte modesta, doar 38% dintre pacienti obtinand raspuns virusologic sustinut.  Analizand explicatiile posibile, am evidentiat prezenta a doi predictori negativi semnificativi: procentul mare de pacienti cu genotipuri non-CC IL28B si pre-existenta mutatiilor in pozitiile 70 si 91 din gena core VHC.

P3 a realizat si studiul microARN-125b ca factor de predictie a evolutiei naturale si sub tratament la pacientii infectati VHC (P3). Au fost investigati 108 pacienti infectati cronic cu virusul hepatitic C. Expresia MiR-125b in ser se coreleaza semnificativ cu viremia VHC (p=0.04), cu citoliza hepatica (p=0.02) și cu gradul fibrozei hepatice (p=0.007). Expresia miR-125b in ser a fost semnificativ mai scăzută la pacienții care au obtinut răspuns virusologic timpuriu – EVR (p=0.03 și susținut – SVR (p=0.04) după biterapia cu PEG-interferon plus Ribavirina, sugerând că acest tip de microRNA poate fi implicat in răspunsul la terapia cu IFN, probabil prin interferarea caii de semnalizare a acestuia.

Personal Genetics (P4) a creat si testat impreuna cu P3, Co si ceilalti parteneri, algoritmul de predictie a lipsei de raspuns la tratamentul antiviral. Rezultatele obținute în urma aplicării algoritmilor predictivi și validării lor încrucișate de 10 ori au arătat că cel mai bun clasificator a fost algoritmul xgboost. Clasificatorul xgboost presupune implementarea software a unui algoritm de creștere a gradientului (gradient boosting) bazat pe arbori de decizie. Acesta face parte din categoria tehnicilor de învățare automată (machine learning) pentru probleme de clasificare și produce un model predictiv.

P4. Studiul „in silico” al secvențelor obținute. Modelarea moleculară comparativă a secvențelor de ADNc viral obținute de la tulpini sensibile și rezistente la tratament. Variabilitatea genetică a regiunilor genomului HCV ce codifică pentru proteine implicate in modelarea raspunsului la tratament a fost evaluată prin estimarea numărului și distribuției de substituții non-sinonime de aminoacizi. Au fost analizate regiunile core, p7, NS2, NS3, NS4A și NS5A (60% din numărul total de proteine codificate de genomul HCV) .Substituțiile au fost împărțite în două sub-tipuri: cu frecvență sub 1% și, respectiv, cu o frecvență egală sau mai mare de 1%. Prin secventierea next-generation, doua regiuni genomice virale au fost asociate cu raspunsul la tratament: NS5A prezinta o variabilitatea mare la pacienții cu răspuns virusologic rapid, (dar semnificația statistică nu a putut fi evaluată) si gena NS2 prezinta mai multe mutații non-sinonime cu frecvențe mai mari de 1% la pacienții non-responsivi decât la cei cu răspuns la tratament (cu semnificație statistică, p=0,029)

Consortiul Hepgen, sub coordonarea directorului de proiect Gabriela Oprisan, a elaborat  un ghid cu titlul Managementul tratamentului in hepatita cronica C, care va fi publicat de catre Editura  Universitatii Titu Maiorescu si Editura Hamangiu, cu ISBN 978-606-27-0717-0 /ISBN 978-606-767-029-5.

 

V.5 Studiul populatiei locale: profilului markerilor genetici asociati cu evolutia tratamentului

V.6 Genotiparea tulpinilor HCV in doua regiuni genomice departate (detectarea recombinantilor)

V.7 Analiza statistica a datelor si studiul „in silico” al secventelor obtinute

V.8 Modelarea moleculara comparativa a secventelor de ADN viral obtinute de la tulpini sensibile si rezistente la tratament

V.9 Studiul mecanismelor virale de rezistenta la noile tratamente

V.18 Evaluarea markerilor virali inainte si dupa tratament (pozitiile 70 si 91 din proteina core, variabilitate NS3 si NS5 etc)

P1 a colectat seruri de la 11 pacienţi cu infecţie HCV care au prezentat răspuns viral susţinut (SVR) precum si de la 11 pacienţi non-SVR. Încărcătura virală a fost determinată pentru majoritatea pacienţilor la debutul tratamentului. Pentru doi pacienţi (ECM şi LMC) din categoria „non-responders” s-a determinat încărcătura virala atât la iniţierea tratamentului cât şi după incheierea acestuia. Pentru restul pacienţilor s-a determinat încărcătura virală în timpul tratamentului (4/24 SIT: „4/24 săptamâni în timpul tratamentului”) sau după încheierea terapiei (24/60 SDT: „24/60 săptămâni după tratament”).

Serurile din acest lot au fost utilizate in institutia CO pentru studierea regiunilor genomice virale core şi NS3 protează din genomul HCV.

Studiul a constat în analiza clonală a regiunii NS3 la pacienţi cu hepatită cronică. Pentru acest obiectiv au fost selectaţi alţi 3 pacienţi (#9, #12, #25) diagnosticaţi cu hepatită cronică cu virus C subtip 1b şi complicaţii asociate acestei infecţii (carcinom hepatocelular). Toţi pacienţii din acest lot sunt bărbaţi cu vârsta cuprinsă între 63 şi 66 ani.

Extracţia ARN viral din ser. ARN viral a fost extras din 140 µL ser utilizand kitul comercial QIAamp Viral Mini Kit (Qiagen). Materialul genetic a fost eluat în 60 µL tampon AVE disponibil în kit. Pentru prevenirea degradării enzimatice a ARN, s-au adăugat 40 U inhibitor de RN-aze (RNasin® Ribonuclease Inhibitor, Promega). Soluţiile de ARN au fost stocate la -70ºC pâna la momentul utilizării.

Reverstranscrierea genomului HCV. S-a realizat utilizând primeri „random hexamers” (Promega) şi AMV RT (Avian Myeloblastosis Virus Reverse Transcriptase, Promega). Iniţial, 20 µL soluţie ARN au fost incubaţi cu 4 µL soluţie „random hexamers” (150 µg/mL) timp de 5 minute la 70ºC. Etapa este necesară pentru a „topi” structurile secundare realizate de moleculele ARN. După incubare, amestecul este rapid răcit pe gheaţă şi se adaugă 16 µL mix de reverstranscriere. Compoziţia finală a mixului de reacţie este următoare: 8 µL tampon de reacţie concentrat 5X, 500 nM pentru fiecare dNTP, 20 U AMV RT, 48 U RNasin şi apă până la volumul final de 40 µL. Reverstranscrierea s-a realizat timp de 1.5 h la 42ºC.

Amplificarea prin seminested PCR a unui fragment din regiunea core a genomului HCV. Procedura constă în amplificarea unui fragment de 422 nt. localizat între poziţiile 297-718 (numerotare conform secvenţei genomului tulpinii H77, GenBank acc. no. AF009606) din genomul HCV. Pentru obţinerea acestui fragment am utilizat primeri descrişi în literatura de specialitate listaţi în Tabelul 1 Fragmentul amplificat codifică şi aminoacizii din poziţiile 70 şi 91 căror substituţii sunt predictori negativi ai evoluţiei infecţiei cu HCV subtipul 1b.

 

Tabel 1. Primeri utilizaţi pentru amplificarea markerilor moleculari din genomul HCV

Denumire primer               Secvenţă

                (5′à3′)

Localizare* şi polaritate
CO-1S TAGGGTGCTTGCGAGTGCCCC 297-317; sens
CO-2AS ATGTACCCCATGAGGTCGCC 751-732; antisens
CO-3AS AGGGTATCGATGACCTTAC 718-700; antisens
s2359 AGRTAYTGCCCTGYTCCTTY 2359-2378; sens
a5071 TTRGTYTGGGACARRAARTG 5071-5052; antisens
Primer G GAGCCCGTCGTCTTCTC 3255-3271; sens
Primer J AGGAACTTGCCGTAGGTGGAGTA 4240-4218; antisens
P1b0 TCGTCTTTTCTGACATGGAG 3262-3281; sens
P1b1 TTGTACCCTTGGGCTGCATA 4090-4071; sens

* numerotare conform secvenţei genomului tulpinii H77, GenBank acc. no. AF009606

Pentru prima rundă de PCR am utilizat primerii CO-1S şi CO-2AS  iar pentru runda a doua perechea CO-1S şi CO-3AS (Tabelul 1). Compoziţia mixurilor PCR pentru cele două runde sunt prezentate în Tabelul 2. Pentru ambele runde de amplifcare s-a utilizat acelaşi profil termic: 94C, 3’; 40 cicluri amplificare (94C, 30”; 60-51C, descreştere un grad/2 cicluri, 30”; 72C, 30”); 72C, 7′.

Tabel 2. Compoziţia mixurilor PCR pentru amplificarea unui fragment din regiunea core a genomului HCV

Reactiv Runda I PCR Runda II PCR
Concentraţie Volum(µL) Concentraţie Volum(µL)
Apă 26.7 26.7
Tampon 5X 10 5X 10
MgCl2 25 mM 3 25 mM 3
Mix dNTPs 10 mM 1 10 mM 1
Primer CO-1S 10 µM 2 10 µM 2
Primer  CO-2AS 10 µM 2
Primer  CO-3AS 10 µM 2
GoTaq Pol (Promega) 5U/µL 0.3 5U/µL 0.3
ADN complementar 5
ADN obţinut în prima rundă PCR 5
TOTAL 50 50

 

Amplificarea prin nested PCR a regiunii proteazei NS3 din genomul HCV. Pentru studiul întregii regiunii NS3 protează (543 nt.) am amplificat un fragment de 829 nt. folosind priemri descrişi în literatura. Compoziţia mixurilor PCR pentru cele două runde sunt prezentate în Tabelul 3. Profilul termic utilizat în prima rundă PCR este: 95C, 2’; 35 cicluri amplificare (95C, 30”; 53C, 30”; 72C, 1’); 72C, 7′. Pentru cea de-a două rundă am folosit un profil similar dar cu temperatura de hibridizare de 50C.

 

Tabel 3. Compoziţia mixurilor PCR pentru amplificarea unui fragment ce conţine regiunea NS3 protează

Reactiv Runda I PCR Runda II PCR
Concentraţie Volum(µL) Concentraţie Volum(µL)
Apă 26.7 26.7
Tampon 5X 10 5X 10
MgCl2 25 mM 3 25 mM 3
Mix dNTPs 10 mM 1 10 mM 1
Primer G 10 µM 2
Primer J 10 µM 2
Primer P1b0 10 µM 2
Primer P1b1 10 µM 2
GoTaq Pol (Promega) 5U/µL 0.3 5U/µL 0.3
ADN complementar 5
ADN obţinut în prima rundă PCR 5
TOTAL 50 50

 

Secvenţierea directă a ampliconilor. Ampliconii au fost purificaţi din gel utilizând kitul comercial Wizard® SV PCR and Gel Clean-Up System (Promega) conform indicaţiilor producătorului. ADN purificat a fost dozat cu fluorimetrul Qubit (Invitrogen) şi kitul HS dsDNA assay kit (Invitrogen). Secvenţierea directă a ampliconilor am realizat-o cu kitul BigDye Terminator v3.1 (Applied Biosystems) conform instrucţiunilor producătorului. Pentru acurateţea rezultatelor au fost secvenţiate ambele catene. Produşii reacţiei de secvenţiere au fost purificaţi cu kitul DyeEx 2.0 Spin Kit (Qiagen) conform instrucţiunilor producătorului. Fragmentele rezultate în urma reacţiei de secvenţiere au fost analizate prin electroforeză capilară (3130 Genetic Analyzer, Applied Biosystems).

Analiza bioinformatică a secvenţelor ADN. Secvenţele obţinute au fost inspectate vizual şi editate cu software-ul BioEdit şi comparate cu secvenţe similare depuse în GenBank/EMBL/DDBJ. Arborii filogenetici au fost construiţi cu programul Mega 5, metoda statistică NJ, 1000 bootstraps. Detecţia mutaţiilor din regiunea codifcatoare pentru proteaza NS3 s-a realizat cu softul on-line Geno2pheno [hcv] 0.9.

Analiza moleculară a regiunii core. Pentru 22 din cele 24 probe ser analizate s-a obţinut un amplicon de dimensiunea aşteptată (Fig. 1). Pentru proba SVB-R10, care deşi prezintă o încărcătură virală mare (335 000 UI/mL), nu s-a obţinut ampliconul specific. În cazul probei SVB-R17, eşecul amplificării poate fi justificat prin încărcătura virală mică (19 200 UI/mL), aceasta fiind proba cu încărcătura virală cea mică din întregul lot de studiu.

fig1

Fig. 1. Electroforegrama ampliconilor core (422 nt). Rândurile 2-8, 10-15, 17-22, 24-28: probele SVB-R01-SVB-R24. Rândurile 1, 9, 16 şi 23: standard de masă moleculară (100 pb, Promega). Rândul 29: martor negativ

Pentru 21 din cele 22 probe pozitive prin PCR am obţinut o secvenţă ADN. Analiza secvenţelor s-a realizat pe un fragment comun de 240 nt. localizat între poziţiile 390-629 (conform secvenţei HCV H77, GenBank acc. no. AF009606). Tipizarea bazată pe acest fragament indică apartenenţa tuturor tulpinilor studiate la subtipul 1b şi plasează secvenţele studiate alături de alte secvenţe obţinute de la pacienţi români în 2003, 2004, 2006 şi 2008 (Fig. 2).

fig2

Fig. 2 Arbore filogenetic construit prin metoda NJ, 1000 bootstrap şi bazat pe un fragmet de 240 nt. din regiunea core a HCV. secvenţe obţinute în studiul de faţă, secvenţe obţinute de la alţi pacienţi români

În ceea ce priveşte prezenţa mutaţiilor din poziţiile 70 respectiv 91 din proteina core, am identificat 4 pacienţi infectaţi cu tulpini HCV care prezintă simultan mutaţiile R70Q şi L91M. Mutaţia L91M a fost identificată singură la 9 pacienţi. De asemenea, la un pacient am identificat şi mutaţia R70H dar neînsoţită de o mutaţie în poziţia 70. Restul pacienţilor pentru care s-a obţinut o secvenţa pentru fragmentul core nu au prezentat mutaţii în poziţiile 70 şi 91 din proteina core (Fig. 3). La acest lot se remarcă frecvenţa mai mare a mutaţiei din poziţia 91 faţă de cea din poziţia 70. Deşi factorii virali au o valoare predictivă mare, aceştia nu pot fi utilizaţi decât impreună cu alţi factori precum cei ai gazdei (genetici şi non-genetici).

 

fig3

 

Fig. 3 Secvenţele de amino-acizi deduse pentru un fragment din proteina core a HCV (poziţiile 1-96). Poziţiile 70 şi 91 pot prezenta mutaţii de rezistenţă la tratamentul cu PEG-IFN şi ribavirină

 

Analiza moleculară a regiunii NS3 protează. Pentru 18 din cele 24 probe ser analizate s-a obţinut un amplicon de dimensiunea aşteptată (Fig. 4). Toate cele 18 probe PCR pozitive au fost secvenţiate.

 fig4

Fig. 4. Electroforegrama ampliconilor NS3 protează (829 nt). Rândurile 2-14, 17-27: SVB-R01-SVB-R24. Rândurile 1, 15, 16, 29: standard de masă moleculară (100 pb, Promega). Rândul 28: martor negativ

 

Analiza mutaţională a întregului domeniu proteazic NS3 (181 amino-acizi) pentru cele 18 probe secvenţiate a relevat existenţa mutaţiei I132V la 12 pacienţi (Fig. 5). In vitro, această substituţie conferă o rezistenţă scăzută la telaprevir (<creştere de 2 ori a concentraţiei eficiente medie [EC50]) [42]. Este de menţionat că pacienţii înrolaţi în acest studiu nu au fost trataţi cu telaprevir/boceprevir. Celelalte probe nu prezintă mutaţii de rezistenţă la inhibitorii de proteaze.

fig5

Fig. 5 Secvenţele de amino-acizi deduse pentru domeniul proteazic NS3 (181 amino-acizi). Poziţia 132 poate prezenta mutaţii de rezistenţă la telaprevir

Un studiu recent a identificat substituția T54S la 6,85% dintre pacienții naivi la telaprevir si boceprevir, infectati cu HCV genotip 1 [Shepherd SJ, 2015]. De asemenea, această substitutie a fost găsită la 37% dintre pacienții infectați cu VHC  1b care nu au atins RVS după terapia cu boceprevir [Barnard RJ, 2013]. Clonele NS3 de la un alt pacient cu hepatită C cronică nu prezinta mutații de rezistență la cei doi inhibitori ai proteazei virale, dar au o diversitate genetică mai mare, cu posibile implicatii in aparitia mutațiilor de rezistență. Prin aceste studii am identificat mutații care conferă rezistență scăzută sau medie pentru antiproteazice de prima generatie la pacienti naivi pentru acest tip de tratament.  In acest context, ar putea fi utila testarea pacienților înainte de expunerea la inhibitori de protează,  pentru a se detecta mutațiile de rezistență. Așa cum a fost dovedit pentru simeprevir, un alt inhibitor de protează, testarea pentru substituția NS3 Q80K este necesară pentru toate cazurile de infecții cu subtipul 1a, deoarece tulpinile care au această mutație înainte de tratament reduc șansele de a se obține RVS, cu până la 58% (EASL recommendations on treatment of hepatitis C 2015). Genotiparea prin secventierea probelor in cele doua regiuni nu a detectat virusuri recombinante.

Analiza datelor rezultate in urma secventierii next-generation – P4. În cursul acestei etape a fost îmbunătățită modalitatea de analiză a datelor rezultate în urma pirosecvențierii pentru a crește sensibilitatea și specificitatea cu care sunt detectate haplotipurile (cvasispeciile) virale.

Achizitia de imagine si prelucrarea primara au fost efectuate cu sistemul GS FLX (Roche 454 secventiere) iar un computer Roche Titan Cluster a fost utilizat pentru prelucrarea datelor de tip shot-gun. Secvențele extrase pentru fiecare probă au fost apoi filtrate folosind software-ul mothur pentru a exclude citirile cu ambiguități (homopolimeri mai lungi de 8 baze și o calitate medie mai mică de 35, în orice fereastră de 50 pb). Contigii au fost asamblați cu ajutorul software-ului Vicuna, optimizat pentru populații virale cu diversitate mare. Finisarea și reorientarea contigilor, precum și adnotarea (izolatul CON1 al HCV1b a fost utilizat ca referință genomică) și corecțiile de secvențe au fost realizate folosind V-FAT. Contigii au fost verificați manual pentru a corecta o eroare de homopolimer care inițial a dus la schimbări în cadrul de citire. Corectarea erorilor specifice pirosecvențierii a fost făcută cu ajutorul software-ului RC454.

Variațiile de secvență (polimorfisme unice de nucleotide -SNP și polimorfisme ale lungimii – LP) au fost identificate cu ajutorul V-Phaser 2 Software. Mutatiile Core cu o frecvență de peste 20% au fost confirmate prin secvențiere Sanger. Software-ul ShoRAH a fost utilizat pentru reconstrucția haplotipurilor virale.

Analiza statistică. Toate datele au fost exprimate ca medie ± deviație standard sau valori absolute, iar analiza statistică a fost realizată cu ajutorul SPSS 20.0 pentru Windows (SPSS Inc., Chicago, IL, USA). Testul Shapiro-Wilk a fost efectuat pentru a evalua normalitatea distribuției datelor. Testul t a fost utilizat pentru a compara variabilele distribuite normal și testul Mann-Whitney U a fost utilizat pentru variabilele cu distribuție non-gaussiană între grupuri. Pentru toate testele statistice P <0,05 a fost considerată semnificativă.

Diversitatea intra- și inter-gazdă. Diversitatea intra- și inter-gazdă a fost testată calculând diferențele pairwise și distanța Tajima-Nei, așa cum sunt implementate în softul Arlequin, ver. 3.5.

Analiza filogenetică. Analiza filogenetică a fost efectuată pe secvențele virale reconstruite la nivel de haplotip (aproximativ 7500 de nucleotide) obținute pentru fiecare pacient cu ShoRAH. Secvențele de nucleotide au fost aliniate utilizând software-ul on-line Clustal Omega. MEGA v6.0 a fost folosit pentru a deduce istoricul evolutiv folosind metoda Neighbor-Joining cu modelul de substituție Tajima-Nei. Arborele consens dedus din 1000 replici bootstrap este considerat reprezentativ pentru istoria evolutivă a taxonilor analizați.

Rezultate NGS. În urma filtrării pe baza unor criterii de calitate a rezultatelor brute, au rezultat 1.069.542 de secvențe totalizând 424.886.322 baze. Secvențele au avut o lungime mediană de 450 baze și un scor de calitate mediu de 30.81

În experimentul prezentat am secvențiat și o bibliotecă de ampliconi provenind de la izolatul Con1 pentru a estima rata globală de eroare a procesului de secvențiere, ce include erorile de amplificare (etapele de obținere a ampliconilor și cea de amplificare emPCR) și erorile de citire ale sistemului.

Variabilitatea genetică a HCV. Variabilitatea genetică a regiunilor genomului HCV ce codifică pentru proteine implicate in modelarea raspunsului la tratament a fost evaluată prin estimarea numărului și distribuției de substituții non-sinonime de aminoacizi. Au fost analizate regiunile core, p7, NS2, NS3, NS4A și NS5A (60% din numărul total de proteine codificate de genomul HCV) .Substituțiile au fost împărțite în două sub-tipuri: cu frecvență sub 1% și, respectiv, cu o frecvență egală sau mai mare de 1%. Variabilitatea virală este reflectată de numărul de substituții non-sinonime în proteinele codificate de genomul HCV. Numărul mare de substituții non-sinonime cu o frecvență redusă (<1%) poate sugera o evoluție a genomului viral datorită efectului combinat al adaptabilității și factori ce țin de gazdă sau artefacte de secventiere. Mutatiile in core 70H / Q au fost găsite în cinci și Core 91 in opt probe, din care trei, respectiv șapte cu 100% frecvență. Toate mutațiile cu frecvență de peste 20% au fost confirmate prin secvențiere Sanger. Cu toate acestea, ambele mutatii au fost identificate la doi pacienti, in diferite proportii (SVB016 – 70H 98.62%, 70Q 1,38% și SVB072 – 70Q 96.92%, 70H 3,08%).

Variabilitatea genetică a NS5A și în special a regiunii ISDR-V3 a fost asociată anterior cu un prognostic bun in terapia cu PEG-IFN și Ribavirin. Zonele ISDR au fost secvențiate complet în cinci din cei unsprezece pacienți studiați.

Estimarea variabilității inter-gazdă a fost realizată prin construirea arborilor filogenetici utilizând secvențe genomice ale haplotipuri virale obținute pentru fiecare pacient. Având în vedere variabilitatea genomică ridicată în toate probele testate, numărul de haplotipuri reconstruit cu ajutorul software-ului ShoRAH a fost extrem de mare, astfel doar cele cu o frecvență mai mare de 1% au fost selectate pentru analiza filogenetică. Cel mai mare număr de haplotipuri cu o frecvență peste 1% au fost înregistrate pentru pacientul R4, în timp ce, la polul opus, SVB019 a prezentat un singur tip viral. Având în vedere că similitudinea secvenței de nucleotide HCV între pacienți este ~ 90%, distribuția haplotipurilor sugerează că odată ajunse în organism, izolatele virale pot evolua diferit, în funcție de factori ce țin de gazdă.

 

 

  1. 14 Stabilirea corelatiilor intre markerii serologici (IP10 etc), virali si genetici umani

V.16 Studiul epidemiologic al factorilor genetici si non-genetici responsabili pentru esecul terapeutic

V.17 Determinarea incarcaturii virale pre/post-tratament la 4, 12, 24/48 saptamani si la sase luni dupa tratament

  1. 10.Crearea si testarea algoritmului de predictie a lipsei de raspuns la tratamentul antiviral

V.12 Dezvoltarea unui soft utilizabil pentru predictia raspunsului la tratament inaintea inceperii terapiei

V.13 Selectarea pacientilor candidati pentru tri-terapie (IFN/RBV/inhibitori de proteaza)

V.15 Transfer de tehnologie intre partenerii consortiului

 

Identificarea profilului markerilor genetici asociati cu evolutia tratamentului si studiul factorilor virali responsabili pentru esecul terapeutic.  In vederea definirii algoritmului de predictie a non responderilor la tratamentul antiviral clasic si selectiei pacientilor candidati pentru tratamente Interferon-free, partenerul 3 a completat baza de date cu rezultatele legate de polimorfismele genetice IL28B, nivelul IP10, si sCD26 determinate pentru toti pacientii inrolati in studiu si a realizat, impreuna cu coordonatorul proiectului si ceilalti parteneri, analiza integrata a acestora. Per anasamblul lotului rata de succes terapeutic a fost foarte modesta, doar 38% dintre pacienti obtinand raspuns virusologic sustinut.  Analizand explicatiile posibile, am evidentiat prezenta a doi predictori negativi semnificativi:

– Procentul mare de pacienti cu genotipuri non-CC IL28B (82.4%). Intr-adevar, cinetica scaderii viremiei si gradul de raspuns virusologic sunt influentate major de acest parametru genetic:  analizand pacientii cu genotip  CC  vs. cei cu genotip non CC observam o triplare a ratei de succes terapeutic (figura 6)

fig6

Figura 6. Rate de raspuns virusologic asociate genotipului IL28B

– Pre-existenta unor mutatii in gena core VHC au fost asociate, la pacienti de rasa asiatica, cu esecul la tratamentul cu IFN, precum si cu rezistenta la insulina si aparitia carcinomului hepatocelular. Rezultatele noastre confirma acesta asociere si la pacientii de rasa caucaziana si doar 12% dintre pacientii studiati prezinta tulpina virala fara muatii in gena core, in schimb 71.4% prezinta mutatia L91M; 48.7% mutatia R70Q, iar 39.5% au mutatii in ambii codoni (70 si 91). Nu exista diferente in competenta replicativa a tulpinilor salbatice si a celor mutante, nici in gradul de fibroza, respectiv citoliza hepatica (fig 7).

fig7

Figura 7. Caracterele replicative / patologice ale tulpinilor mutante VHC

 

In plus, am constat o asociere semnificativa intre absenta mutatiilor in gena core si prezenta genotipului favorabil CC al  IL28B (figura 8).

 

fig8

Figura 8. Asocieri ale mutatiilor core cu genotipul IL28B

De asemenea, absenta mutatiilor in gena core este asociata cu succesul therapeutic – pacientii infectati cu tulpini VHC fara mutatii obtin RVS in procente semnificativ crescute, comparativ cu cei care au mutatii in codonii 70/91 core (Fig. 9).

 

fig9

 

Figura 9. Rate de raspuns virusologic asociate tulpinilor VHC mutante core

 

Crearea si testarea algoritmului de predictie a lipsei de raspuns la  tratamentul antiviral

Scopul  proiectului de cercetare HepGen  este de a  evalua  valoarea predictiva negativa a unor factori, atat virali cat si ai gazdei, la pacientii cu infectie cronica VHC care nu au obtinut  RVS in urma terapiei cu Peginterferon si Ribavirina. In acest fel, pe baza acestor factori predictivi, vom putea exclude de la tratament, cu o probabilitate satisfacatoare, pe acei pacienti potentiali non responderi.

In analiza multivariata, dintre factorii prezentati mai sus, doar trei dintre acestia raman predictori independenti pentru succesul terapeutic: vârsta tânără (p <0.001), lipsa de substituțiilor core (p = 0.04) și genotipul CC IL28B (p <0.001) – tabelul 4.

 

Tabel 4. Analiza multivariata a predictorilor RVS

Variabila Adjusted OR 95% CI P
Vârstă (<50 ani) 0.976 0.967-0.986 <0.001
Absența mutațiilor core 4.71 1.10-21.30 0.04
Polimorfismul IL28 B 19.2 4.05-91.40 <0.001

 

Studiul microARN-125b ca factor de predictie a evolutiei naturale si sub tratament la pacientii infectati VHC (P3). Au fost investigati 108 pacienti infectati cronic cu virusul hepatitic C – varsta medie 53.5 ani [22 – 68.3 ani], 59.3% de sex feminin, 44.4% cu incarcare virala baseline scazuta – sub 600.000 IU/mL si 37.9% cu fibroză ușoară sau moderată. Expresia MiR-125b in ser se coreleaza semnificativ cu viremia VHC (p=0.04), cu citoliza hepatica (p=0.02) și cu gradul fibrozei hepatice (p=0.007). Expresia miR-125b in ser a fost semnificativ mai scăzută la pacienții care au obtinut răspuns virusologic timpuriu – EVR (p=0.03 și susținut – SVR (p=0.04) după biterapia cu PEG-interferon plus Ribavirina, sugerând că acest tip de microRNA poate fi implicat in răspunsul la terapia cu IFN, probabil prin interferarea caii de semnalizare a acestuia. Modificarea expresiei microRNA-125b la pacientii cu hepatita cronica C poate fi utilizata pentru aprecierea evoluţiei bolii si poate folosi in viitor atat pentru dezvoltarea unor noi biomarkeri neinvazivi de predictie a evolutiei hepatitei virale C, si eventual, pentru evaluarea unor ţinte terapeutice aditionale.

Elaborarea algoritmului de predicție (P4). Toate analizele au fost efectuate folosind programul SPSS 20.0 pentru Windows (SPSS Inc, Chicago, IL, USA). Într-o primă etapă au fost calculate statisticile descriptive privind variabilele calitatative (tabulare) și cele cantitative (medie, deviație standard, media erorilor standard). Pentru variabilele calitative a urmat apoi o serie de teste încrucișate de tip chi-pătrat (testul  Pearson, corecția de continuitate, raportul probabilităților, testul exact Fisher, test de asociație lineară) între variabilele, gen, vârstă (pragul la 55 ani), rezidență (rural vs urban), mutații de rezistență (core 70 și / sau core 91), genotip IL28B, indice de fibroză hepatică (F0-F2 vs F3, F4) și tipul de răspuns la tratament (RVR, EVR, SVR – rapid / early / sustained viral response). În urma acestor teste au fost selectate variabilele prezentând cea mai strânsă asociere cu răspunsul la terapie. Pentru variabilele cantitative, au fost efectuate teste t pentru egalitatea mediilor, după testarea egalității varianțelor (testul lui Levene). Apoi datele selectate au făcut obiectul unor teste de regresie logistică: probabilitatea log, testul R2 Cox și Snell, testul R2Nagelkerke. Suprapunerea modelului peste observațiile statistice a fost testată prin metoda Hosmer și Lemeshow. Pentru aceste încercări au fost folosite mai multe combinații de variabile.

În final, au fost calculate valori pentru datele lipsă și au fost aplicați o serie de clasificatori:

  • xgboost – implementarea software a unui algoritm de creștere a gradientului (gradient boosting) bazat pe arbori de decizie. Acesta face parte din categoria tehnicilor de învățare automată (machine learning) pentru probleme de clasificare și produce un model predictiv.
  • model bazat pe SVM (support vector machines) cu o funcție kernel RBF (radial basis function)
  • model bazat pe SVM precedat de o reducere a dimensionalității setului de date prin algoritmul SVD (singular value decomposition)
  • clasificator bazat pe arbori de decizie cu alegerea aleatorie a unui subspațiu din setul de date (Random Forest)

Pentru selecția celui mai bun algoritm au fost utilizate criterii de calitate precum aria de sub curba specificitate vs sensibilitate, validarea încrucișată repetată de 10 ori, dimensiunea valorilor reziduale sau deviația standard a valorilor preciziei algoritmilor.

 

Selectarea pacientilor candidati pentru triterapie (IFN/RBV/inhibitori de proteaze)

Specialistii clinicieni de la P1 considera ca aceasta activitate a proiectului nu a fost compatibila cu evolutia actuala a programelor de tratament pentru infectia VHC, atat international cat si in Romania. Intrucat la momentul depunerii aplicatiei acestui proiect triterapia IFN+ RBV+ inhibitori de proteaza reprezenta standardul terapeutic in lume, dar nu si in Romania, unde nu se implementasera inca aceste programe prin rambursare CNAS, s-a considerat ca aceasta etapa va fi iminenta in cursul derularii proiectului. Nu se putea prevede avansul cercetarii in domeniul DAA si terapiei Interferon- free, care a facut ca aceasta sa ajunga intr-un timp scurt noul standard terapeutic international, adoptat si in Romania in 2015 (unde s-a sarit practic peste etapa triterapiei). In ce priveste selectarea pacientilor pentru una dintre formele de tratament disponibile prin programul CNAS pentru pacientii infectati cu virus C, se stie ca la nivel international se recomanda caz diagnosticat= caz tratat cu medicatie DAA, in timp ce in Romania aceasta varianta este momentan disponibila numai pentru categoria de pacienti cu ciroza hepatica cu virus C (fibroza hepatica F4, scor Child A).

Din acest motiv consortiul considera ca algoritmul de predictie a lipsei de raspuns la  tratamentul antiviral se poate constitui intr-un sistem aplicabil inca pacientilor care nu prezinta ciroza hepatica dar si un model de dezvoltare a unui algoritm de predictie pentru tratamentele de noua generatie (DAAs etc.).

 

V.1 Elaborarea unui ghid despre managementul tratamentului hepatitei C

V.11 Transferul rezultatelor proiectului autoritatilor medicale nationale

Consortiul Hepgen, sub coordonarea directorului de proiect Gabriela Oprisan, a elaborat  un ghid cu titlul Managementul tratamentului in hepatita cronica C, care va fi publicat de catre Editura  Universitatii Titu Maiorescu si Editura Hamangiu, cu ISBN 978-606-27-0717-0 si ISBN 978-606-767-029-5. Manualul are urmatorul cuprins:

CAPITOLUL 1. ISTORICUL TRATAMENTULUI  INFECŢIEI CRONICE VHC

Laurenţiu Micu. Mariana Mihăilă, Monica Ecobici, Mihai Voiculescu

CAPITOLUL 2. BAZELE TRATAMENTULUI ANTIVIRAL ÎN INFECŢIA VHC

Camelia Sultana, Simona Ruţă

CAPITOLUL 3. ASPECTE CLINICE ALE TRATAMENTULUI ÎN HEPATITA CRONICĂ CU VIRUS C

Simin-Aysel Florescu, Alma Gabriela Kosa, Emanoil Ceauşu, Petre Iacob Calistru

CAPITOLUL 4. INFECŢIA CU VIRUSUL  HEPATITIC C LA POPULAŢII SPECIALE

Cristiana Oprea, Petre Iacob Calistru, Emanoil Ceauşu

CAPITOLUL 5. TRATAMENTUL DETERMINĂRILOR EXTRAHEPATICE ÎN INFECŢIA VHC

Monica Ecobici, Laurenţiu Micu. Mariana Mihăilă, Mihai Voiculescu

CAPITOLUL 6. MANAGEMENTUL  INFECŢIEI VHC PRIVIND PROFILAXIA  REINFECŢIEI POSTRANSPLANT HEPATIC

Mariana Mihăilă

CAPITOLUL 7. REZISTENŢA  LA ANTIVIRALELE CU ACŢIUNE DIRECTĂ

Camelia Sultana, Simona Ruţă

CAPITOLUL 8. FACTORII PREDICTIVI  AI RĂSPUNSULUI LA TRATAMENT – RVS  ŞI AI NON-RĂSPUNSULUI VIRUSOLOGIC

Camelia Sultana, Simona Ruţă, Sorin Dinu,  Sonia Spandole-Dinu, Gabriela Oprişan

CAPITOLUL 9. TEHNOLOGII UTILIZATE  PENTRU STUDIUL MECANISMELOR  DE REZISTENŢĂ. PERSPECTIVE

Gabriela Oprişan, Sorin Dinu, Eugen Radu, Gabriela Bucur, Roxana Sandulovici

Cartea, tiparita in 200 ex., va fi distribuita atat in institutiile din consortiu, la bibliotecile din facultatile de medicina si farmacie din Universitatea Titu Maiorescu si UMF cat si catre autoritatile medicale ntionale, fiind vizate: Comisia de Boli Infectioase a Ministerului Sanatatii si /sau – Comisia de Experti de la nivelul Casei Nationale de Asigurari de Sanatate pentru Tratamentul Specific al Hepatitelor Cronice si Cirozei Hepatice de Etiologie Virala, precum si pentru Boala Inflamatorie Cronica Intestinala.

V.2 Comunicarea si publicarea rezultatelor proiectului – prezentate la Indicatori de proces si de rezultat

 

V.4 Stagiu de perfectionare in bioinformatica si analiza datelor de next-generation sequencing a dr. CS biochim Sorin Dinu din INC Cantacuzino (institutia coordonatoare): C3BI Hands–‐on NGS course, Paris, in perioada 21 nov.- 2 dec. 2016 (Center for Bioinformatics, Biostatistics and Integrative Biology – Institut Pasteur, Paris). Stagiul este cofinantat  de Institutul Pasteur, Paris.

 

 

 

 

 

Concluzii

 

  1. Prin analiza genetica a doua regiuni din genomul HCV am identificat mutații care conferă rezistență scăzută sau medie pentru antiproteazice de prima generatie la pacienti naivi pentru acest tip de tratament.

 

  1. Rezultatele noastre confirma studiile realizate in Asia privind asocierea intre pre-existenta unor mutatii in gena core HCV cu esecul la tratamentul cu IFN, precum si cu rezistenta la insulina si aparitia carcinomului hepatocelular. Doar 12% dintre pacientii studiati prezinta tulpina virala fara muatii in gena core, in schimb 71.4% prezinta mutatia L91M; 48.7% mutatia R70Q, iar 39.5% au mutatii in ambii codoni (70 si 91). Nu exista diferente in competenta replicativa a tulpinilor salbatice si a celor mutante, nici in gradul de fibroza, respectiv citoliza hepatica

 

  1. Absenta mutatiilor in gena core si prezenta genotipului favorabil CC al IL28B sunt asociate cu succesul therapeutic

 

  1. Expresia miR-125b in ser a fost semnificativ mai scăzută la pacienții care au obtinut răspuns virusologic timpuriu – EVR, p=0.03 și susținut – SVR, p=0.04 după biterapia cu PEG-interferon plus Ribavirina, sugerând că acest tip de microRNA poate fi implicat in răspunsul la terapia cu IFN, probabil prin interferarea caii de semnalizare a acestuia. Modificarea expresiei microRNA-125b la pacientii cu hepatita cronica C poate fi utilizata pentru aprecierea evoluţiei bolii si poate folosi in viitor atat pentru dezvoltarea unor noi biomarkeri neinvazivi de predictie a evolutiei hepatitei virale C, si eventual, pentru evaluarea unor ţinte terapeutice aditionale.
  2. În privința elaborării unui algoritm predictiv al răspunsului la terapia PEG-IFN + ribavirină, cel mai bun clasificator este xgboost (~75%). Clasificatorul utilizat este xgboost – implementarea software a unui algoritm de creștere a gradientului (gradient boosting) bazat pe arbori de decizie. Acesta face parte din categoria tehnicilor de învățare automată (machine learning) pentru probleme de clasificare și produce un model predictiv.
  3. In contextul actual, al coexistentei tratamentului PegIFN + Ribavirin cu noile tratamente Interferon free, in programul de subventie al Casei Nationale de Asigurari de Sanatate (CNAS), rezultatele oferite de cercetarea in cadrul proiectului privind factorii de rezistenta la Interferon, se pot constitui in argumente pentru un mai bun management al acestei categorii de pacienti (cu factori de rezistenta pozitivi): de exemplu, este de la sine inteles faptul ca un pacient cu genotip Interleukina B28 de tip TT nu va putea beneficia niciodata de tratamentul cu Interferon, la care va fi rezistent si ca atare se pot adauga criterii de tratament in protocolul CNAS, care sa se refere la aceasta categorie de pacienti, astfel incat acestia sa poata beneficia de tratamentul Interferon free si intr-un stadiu pre F4 (P1)
  4. Consortiul Hepgen, sub coordonarea directorului de proiect Gabriela Oprisan, a elaborat  un ghid cu titlul Managementul tratamentului in hepatita cronica C, care va fi publicat de catre Editura Universitatii Titu Maiorescu/Editura Hamangiu

 

 

 

 

Indicatori de proces si de rezultat

Indicatori de proces

Numarul de proiecte realizate in parteneriat international: nu se aplica

 

Mobilitati internationale – nu se aplica

Indicatori de rezultat

 

P1

 

  1. S A Florescu, St Lazar, C Oprea, A Motoc, D Codreanu, A G Kosa, Em Ceausu

+ grupul de lucru proiect PN II PT PCCA 88/ 2011. Tratamentul cirozei hepatice cu virus hepatitic C cu interferon pegylat- ribavirina si interferon free – studiu comparativ “ in curs de aparitie in Revista Romana de Boli Infectioase, Vol. XIX, Nr 4, 2016

 

P2

 

Domnul Profesor Mihai Voiculescu a participat la mai multe intalniri internationale care au avut ca subiect virusurile hepatitice (The International EASL  Liver Congress– Barcelona 13-17 aprilie 2016, Digestive Disease Week 2016 ,21-24 mai 2016, San Diego, SUA, Al 36-lea Congres de Gastroenterologie, Hepatologie si Endoscopie Digestiva, Cluj, 8-11 iunie 2016).

 

Domnul Profesor Mihai Voiculescu a participat la 9th Paris Hepatitis Conference (11-12 ian 2016) si a prezentat lucrarea ” How to improve acces therapy?Around the world table  “.

 

Dr Laurentiu Micu a participat la Al 36-lea Congres de Gastroenterologie, Hepatologie si Endoscopie Digestiva, Cluj, 8-11 iunie 2016, iar in cadrul manifestarilor stiintifice : Conferinta Nationala Medicina Bazata pe Dovezi (Brasov, 3-5 nov 2016) si Synevo Clinical Trial Symposium (8th edition) (Bucuresti, 25 noiembrie 2016) a prezentat lucrarea “ Studiile clinice în tratamentul infecției cronice VHC: o poveste de succes“.

 

D-na Dr Mariana Mihaila a participat la Al 36-lea Congres de Gastroenterologie, Hepatologie si Endoscopie Digestiva, Cluj, 8-11 iunie 2016, la Al 16-lea Congres National de Medicina Interna, Calimanesti-Caciulata, 7-9 aprilie 2016, la ELITA 2-nd Monothematic Conference (Liver Transplantation in HCV or HBV positive recipients: where we are and where we are going), Milano, 1 aprilie 2016 si la 26th International Congress of The Transplantation Society, Hong Kong, 18-23 august 2016.

 

In perioada  6-8 octombrie 2016, la Hotelul Pullman Bucuresti, partenerul P2 a organizat  Al XXVI –lea Congres National de Hepatologie, Al VI-lea Congres de Hepatologie Romano-Francez si al VII-lea Curs Balcanic de Hepatologie, cu participare nationala si internationala. Manifestarea a fost creditata cu 20 ore EMC.

In cadrul acestei  manifestari, D-na Prof Dr Simona Ruta a prezentat lucrarea” Who might still benefit from the interferon-based therapies in chronic hepatitis C in 2016″ , iar D-na Dr Gabriela Oprisan a prezentat lucrarea ” Patterns of HCV mutations”.

 

P3

Pentru diseminarea rezultatelor legate de implicarea factorilor virali si genetici in evolutia a pacientilor cu hepatita cronica C, partenerul 3 a publicat in colaborare cu Co si alti membri ai consortiului doua articole in reviste indexate ISI:

  1. Camelia Sultana, Gabriela Oprişan, Monica Delia Teleman, Sorin Dinu, HepGen Project 88/2012 Team; Cristiana Oprea, Mihai Voiculescu and Simona Ruta. Impact of hepatitis C virus core mutations on the response to interferon-based treatment in chronic hepatitis, World J Gastroenterol 2016; 22(37): 8406- 8413,  DOI: http://dx.doi.org/10.3748/wjg.v22.i37.8406  FI=787
  2. Camelia Sultana, Gabriela Oprişan, Camelia Grancea, Monica Delia Teleman , Cristiana Oprea, Simin Florescu, Sorin Dinu, Emanoil Ceausu, Simona Ruta. Interferon-gamma Inducible Protein 10 – biomarker for treatment outcome in chronic hepatitis C. Romanian Biotechnological Letters, FI=0.404, Accepted, July 3, 2016, in press, http://www.rombio.eu/.

 

De asemenea, in aceasta etapa Partenerul 3 a sustinut trei prezentari la conferinte nationale cu participare internationala si cu rezumat publicat în reviste ISSN:

 

  1. Simona Ruta. Who might still benefit from the interferon-based therapies in chronic
    hepatitis C in 2016? Al XXVI-th Congres National de Hepatologie, 6-8 oct 2016, Bucuresti
  2. Camelia Sultana, Adelina Rosca, Camelia Grancea, Claudia Dita, Simona Ruta. Expresia miRNA 125b in hepatita cronica C. A IX-a Conferință Națională de Microbiologie și Epidemiologie, 20-22 oct 2016, Brasov, P14, rezumat publicat în revista Bacteriologia, Virusologia, Parazitologia, Epidemiologia, Vol.61, nr. 3-4, 2016, p 73, ISSN: 1220-3696
  3. Camelia Sultana . Rolul miRNA in progresia hepatitelor cronice virale si evolutia spre carcinom hepatocelular, Congresul UMF  “Carol Davila”, Editia 4, Bucuresti, 2-4 iunie 2016, rezumat publicat în revista Maedica, A Journal of Clinical Medicine, Suppl 2016, ISSN 1841-9038  |  e-ISSN 2069-6116

 

P4

 

Se află în curs de revizuire în vederea publicării în revista Journal of Virlogical Methods (ISSN: 0166-0934, factor de impact 1,642) articolul intitulat „Ultra deep sequencing assessment of genetic variability in hepatitis C virus infecting Romanian patients”, autori Spandole-Dinu S, Radu E, Dinu S, Cardos G, Tardei G, Calistru PI, Ceausu E, Voiculescu M, Ruta S, Sultana C, Oprisan G.

 

Co – publicarea unor articole (citate mai sus)

 

participari la conferinte cu publicarea articolelor

  1. Gabriela Oprişan, Sorin Dinu, “Aspecte ale rezistenţei virusului hepatitei C la antivirale“, Workshop al Facultăţii de Farmacie din Universitatea “Titu Maiorescu”, Bucureşti, 13 mai 2016, in press
  2. Gabriela Oprişan, Sorin Dinu si consortiul proiectului HepGen, « Mutatii de rezistenta in genomul virusului Hepatitei C ». Al XXVI-th Congres National de Hepatologie, 6-8 oct 2016, Bucuresti
  3. Gabriela Oprişan, Sorin Dinu, Laurentiu Micu, Georgiana Micu, Monica Ecobici, Sonia Spandole, Georgeta Cardos, Mihai Voiculescu. Conferinta si articol. Study of genetic and viral markers associated with non-response to triple therapy for patients with genotype 1 chronic hepatitis C. International Conference “Education and creativity for a knowledge based society” 17-19 noiembrie 2016. Articol in curs de publicare in volumul conferintei.

 

 

 

 

OBIECTIVELE SPECIFICE ALE PARTENERIATULUI:

1. Imbunatatirea starii de sanatate a pacientilor si eradicarea hepatitei C prin transferul in clinica a datelor rezultate din cercetarea stiintifica

2. Dezvoltarea unui algoritm bazat pe factori virali si markeri genetici umani utilizabil in predictia raspunsului la tratamentul cu antivirale

3. Transferul rezultatelor proiectului la autoritatile decidente din domeniul politicii sanitare

4. Investigarea factorilor virali asociati raspunsului viral nul (genotip, variabilitate, cinetica incarcaturii virale)

5. Studii epidemiologice si corelarea factorilor virali cu factorii genetici si non-genetici umani

6. Elaborarea si transferul SOPs (“standard operating procedures”) si MOOs (“manual of operations”) intre partenerii consortiului

7. Construirea unor colectii de izolate virale, ADN uman si a unei banci de date pentru pacienti

8. Crearea unei retele de excelenta dedicata studiului hepatitei C conectata la retelele similare nationale si internationale

Tendințele Gripei în România: 2012 – 2013 Google
Risc Intens
Risc Ridicat
Risc Moderat
Risc Scazut
Risc Minim
Tendintele Gripei in Romania
iunie 2012
iunie 2013

Google Flu Trends, un instrument care furnizează estimări aproape în timp real ale incidenţei gripei în mai multe regiuni ale globului, este disponibil acum şi în România la adresa google.org/flutrends/intl/ro.

Google a constatat că anumiţi termeni de căutare referitori la gripă sunt frecvent utilizaţi în fiecare an în perioada epidemiilor de gripă. Comparând numărul de căutări online cu datele din sistemele tradiţionale de supraveghere a gripei, Google a dezvoltat Flu Trends, ce constituie un sistem util de avertizare în privinţa unor noi epidemii de gripă. 

În România, Google Flu Trends utilizează tendinţele observate în interogările de căutare timp de mai multe sezoane, coroborate cu datele oficiale furnizate de Institutul Naţional de Cercetare-Dezvoltare pentru Microbiologie-Imunologie Cantacuzino (INCDMI – Cantacuzino). 

“Localizarea sistemului Google Flu Trends şi pentru România va furniza informaţii utile şi va semnala tendinţe care pot fi de un real ajutor sănătăţii publice. Folosirea căutărilor online pentru completarea supravegherii naţionale, convenţionale a gripei, va facilita şi va direcţiona măsurile de control, întrucât alerta debutului unei epidemii va putea fi făcută în avans cu cel puţin 7 zile faţă de raportările oficiale ale cazurilor”, a declarat dr. Viorel Alexandrescu, medic primar, doctor în ştiinţe medicale,  Şeful Centrului Naţional de Gripă din reţeaua OMS, INCDMI – Cantacuzino

“Google Flu Trends şi-a dovedit deja eficienţa în monitorizarea epidemiilor şi pandemiilor de gripă în aproape 30 de ţări, şi suntem foarte bucuroşi să colaborăm cu Institutul Cantacuzino pentru a pune la dispoziţia medicilor şi a publicului larg un instrument gratuit ce poate contribui la menţinerea sănătăţii pe perioada sezoanelor de gripă, prin detectarea timpurie a unei epidemii”, a declarat Dan Bulucea, director general Google România. 

Graficele Google Flu Trends sunt bazate pe date anonime şi cumulate provenind de la milioane de căutări Google efectuate în timp, iar rezultatele afişate sunt generate de un sistem automatizat. 
Mai multe informaţii despre Google Flu Trends puteţi afla accesând Flu Trends video.